We narrowed to 21 results for: lacz gene

...the blue-white screen, which relies on the lacZ gene. lacZ encodes the enzyme 𝛽-galactosidase which can...on vectors where the gene of interest is inserted into the middle of the lacZ gene, thus disrupting 𝛽-...strains contain lacZ in their genome, and scientists have found that when a portion of the gene is deleted,...where only cells that have gained or lost a specific gene survive (ex: antibiotic resistance marker). In a...mentioned above. In molecular biology, cloning a gene into your plasmid is often a numbers game. By using...

...showed the expected complete sequence for the lacI/lacZ genes (1), while sequencing of white colonies showed...based on the ability to correctly assemble a lacI/lacZ cassette (designed by NEB for use in optimization...coding sequence for beta-galactosidase in the lacI/lacZ cassette. Additional confirmation of accurate assemblies...blue phenotype. Indeed, this was seen in all lacI/ lacZ assembly test systems; no blue colonies were obtained...from 1-, 12- and 24-fragment assemblies of the lacI/lacZ cassette, and illustrates how the volume of the ...fidelity and assembly efficiency Five fragment lacI/lacZ cassette assembly was easily achievable with high...both the 12- and 24-fragment versions of the lacI/lacZ cassette were designed and synthesized. In conjunction...

...Scientists discovered that deleting a section from the lacZ gene (a mutation called lacZΔM15) creates a non-functional...well-characterized bacterial lac operon contains a gene called lacZ that encodes for the enzyme β-galactosidase...the plasmid containing the lethal gene. An example is the ccdB gene system commonly used in Gateway® Cloning...are rescued by genes supplied on the transformed plasmid. Such plasmids may contain genes that allow for...other methods. Positive selection vectors encode a gene which, when expressed, is lethal to the cell. Cloning...fragments are inserted into an MCS in the center of this gene, disrupting the lethality. This is similar to α-...(used to complement auxotrophic cell lines), or genes which rescue a lethal phenotype. Resources on the...

...Gal4 activator, bacterial LexA DBD and the lacZ reporter gene (3, 4), there are now many variations, including...activation sequence (UAS) of its target gene, in this case a reporter gene (e.g. luciferase or GFP), regardless...promoter of the reporter gene to activate expression (Figure 2c). The reporter gene then allows detection...Shapira S.K., Chou J. Beta-galactosidase gene fusions for analyzing gene expression in Escherichia coli and ...hybrid system (also called the interaction trap), genes encoding proteins of interest(POI’s) are fused to... in a yeast strain that also contains a reporter gene cloned downstream of a promoter containing the target... the “bait”, Figure 2b) cannot activate reporter gene expression on its own, but, if the two POI’s interact...

...coli strains. Table 1: Common gene mutations found in E.coli strains Gene(s) Description Functional Consequence...specific genes are signified with a minus sign (-) as is typically standard; just having the gene listed...carefully selected the optimal promoter for your gene of interest, painstakingly cloned into the perfect...backbone, made sure to add the right tags to your gene, and may have even put a fluorescent protein downstream...methylation sensitive. dnaJ Mutation in a chaperonin gene Increases the stability of certain expressed proteins...encodes proteins needed for bacterial conjugation. Genes listed on F´ are wild-type unless indicated otherwise...overproduced, expression from pLac repressed more   LacZ β-galactosidase activity abolished   lacY Lactose...

...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC...pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose...GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ Reverse LexA CGTCAGCAGAGCTTCACCATTG...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...

...applications used to study gene function. From making transgenic animals, gene targeting and genome modifications...These vectors allow you to test the function of Your Gene Of Interest (YGOI) in a controlled environment under...design. You can create a new strain with a disrupted gene by transforming wild-type yeast with an integrating...involve using a reporter vector to tag YGOI with lacZ and/or GFP (e.g. pPD80_08) and following the expression...modifications to reporter vectors (e.g. pBV-Luc) and gene silencing (e.g. pLKO.1 - TRC cloning vector). Check...

...approaches increase the size of the gene delivered by splitting the gene into two pieces: part A and part...packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. ...editing's PE2 enzyme do not. So how do you fit a big gene into a tiny vector like AAV? By breaking the transgene... fragmented genomes is the key to fitting large genes into AAV First, some history. In 2008, the Auricchio...part B. Each piece of the gene is then independently packaged into an AAV. When a cell is co-infected with...fragments reassemble and produce the full-length gene. Below are overviews and drawbacks of four split...1000bp overlaps to deliver the alkaline phosphatase gene to airway epithelial cells in mice. This vector ...

... allowing for the gene on the toehold switch to be expressed. In this case, the gene encodes the LacZ𝛼..., highly efficient RNAi construct for C. elegans gene knockdown Article contributed by Alyssa Cecchetelli...extensively used in C. elegans research to study gene function. RNAi is commonly achieved by feeding E...pathways making it difficult to link a phenotype to the gene being targeted via RNAi. Recently the Vellai lab...The standard RNAi vector, L4440, places a target gene between two inverted T7 promoters. Transcription... from each promoter progresses past the specific gene producing long unspecific RNA fragments that are...LacZ𝛼 complexes with LacZ𝜔 and forms an active LacZ tetramer.  This tetramer cleaves chlorophenol red-b-D-galactopyranoside...

...pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24 CCKBR...pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27 CCL27...pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30 CD68...pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36 CRH...pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125 ...pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS Ple135...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS Ple181...

...the ccdB gene is replaced by the gene of interest. As a result, cells that retain the ccdB gene die off...tool. The plasmid pKSCTMF contains the mazF gene and a gene for Zeocin resistance (Figure 2). This MazF-ZeoR...antisense RNA regulates hok gene expression indirectly through the overlapping mok gene." Journal of molecular... propagation of themselves and their associated genes. These systems better ensure that plasmids are passed...application of CcdB is GatewayTM cloning, where the ccdB gene serves as a counterselectable marker in the destination...death. The team used this cassette to knock out genes, knock in a GFP cassette, and introduced site-directed...toxin-antitoxin system to construct a stable synthetic gene circuit that can be used over prolonged periods....

...expressing a control -- for example, an FKBP12F36V-tagged LACZ) with dTAG molecules in your biological assay of...endogenous ENL was inactivated using CRISPR/Cas9 gene-editing. Featured molecules: dTAG-7 and dTAG-13 ...endogenous MELK was inactivated using CRISPR/Cas9 gene-editing. Featured molecules: dTAG-7, dTAG-13, and...Homology Directed Repair Plasmids for endogenous gene tagging in human cells Resources on Addgene.org...

...the neuronal-specific gene NeuN. As a control they designed an sgRNA targeting LacZ, which is not present...sgRNA targeted to the mouse NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically...please visit the Addgene SAM library page . Targeted gene activation using SAM There are two sets of 3 vectors...vectors each available for mammalian endogenous gene activation using SAM: Addgene plasmids #61422 - #61424...human codon-optimized, and packages both the SaCas9 gene and its single guide RNA (sgRNA) into one plasmid...

... Depositor Collections Gene Vector Core Viral Vectors Gene Vector Core Viral...remove genes flanked by either loxP or FRT sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter pCDH-EF1s 72484 Express gene of interest from ...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...College of Medicine Gene Vector Core Depositor...

...genome; does not restrict methylated DNA fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10...IPTG. T7 RNAP is then available to transcribe the gene of interest from a T7 promoter on the plasmid. Many...

...Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y MAPT LacZ TRE Parkinson's, FTD Mark Mayford 35000...as fluorescent protein (FP) tags. Information on genes and associated neurodegenerative diseases was curated...but not exhaustive. If you do not see a particular gene of interest, please search our full plasmid collection... Huntington's Disease Parkinson's Disease Others Gene Type Wildtype Mutant Partial Sequence Codon-Optimized... T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI 1177 p416 25Q GPD HTT GFP...

.... briggsae , etc.) gene or sequence: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some...can knock down genes by feeding worms bacteria expressing dsRNA or use CRISPR/Cas9 gene editing to easily...collection. ID Plasmid Description Gene/Insert PI Plasmids Expressing Worm Genes/Inserts The table below lists...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores... the germline. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. - Jane Hubbard...Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression...Editing Efficiency Fluorescent Tagging of Endogenous Genes with SapTrap Even more elegant: Single injection...

...Orthongal Repressors) that can be used to custom repress gene expression in yeast. TALORs consist of the DNA-binding...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii...successfully been employed for deletion mutagenesis and gene targeting in human and mouse pluripotent stem cells...editing was also shown to alter regulation of nearby gene expression. The vectors listed below have the EF1α...

... cassette to the gene of interest. The gene to be expressed is amplified using a gene-specific forward...sgRNA-targeted gene, resulting in increased activation of endogenous transcription of the target gene. The brilliant...of downstream genes. Nihongaki et al describe the targeted activation of endogenous genes and detail the...efficiency and gene expression. The pUCXKT vector ensures that all screened plasmids contain a gene variant*...resistance gene (missing the first two codons). Two stop codons are inserted between the truncated gene and ... inducible, gene knockdown with shRNA or shRNA-miR30, (2) tamoxifen-inducible CreERT2 gene deletion, (...on target gene activation. The novel dCas9-VPR activator is capable of enhancing target gene expression...

...Plasmids containing easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under...knocking out genes or introducing specific mutations can reveal important insights into gene function. These...visualization, study of protein interactions, controlled gene expression, reporter plasmids and genome engineering...transcriptional regulatory elements that will turn on gene expression upon protein–protein interaction. The...always advantageous to constitutively express your gene of interest at high levels. Perhaps high expression...that can be used to reliably drive expression of a gene of interest in E. coli . The Marionette Sensor Collection...independently control the expression of up to twelve genes using small-molecule inducers in the same E. coli...