We narrowed to 28 results for: puro

...Find pLKO.1 - TRC cloning vector. Tet-pLKO-puro - Tet-pLKO-puro contains all the necessary elements for ... by the Weiderschain lab. Find Tet-pLKO-puro. lentiGuide-Puro - This plasmid expresses the S. pyogenes.... Find lentiGuide-Puro. pSpCas9n(BB)-2A-GFP (PX461) - Similar to pSpCas9(BB)-2A-Puro (PX458), pSpCas9n...best to go with pSpCas9(BB)-2A-Puro (PX459) V2.0. Find pSpCas9(BB)-2A-Puro (PX459). Thank you! We would...pX330-U6-Chimeric_BB-CBh-hSpCas9. pSpCas9(BB)-2A-Puro (PX459) V2.0 - This plasmid from the Zhang lab is...less efficient in some cell lines. pSpCas9(BB)-2A-Puro (PX459) V2.0 was made available through Addgene ...available plasmid in the top 15. Find pSpCas9(BB)-2A-Puro (PX459) V2.0. pCMV-VSV-G - pCMV-VSV-G was deposited...

...GFP-Puro will be inserted just upstream of a stop codon. One potential concern is if the GFP-Puro will...detailed protocol for MMEJ-mediated knock-in of a GFP-Puro cassette into a given locus, just upstream of a ...microhomology to the insertion locus flanking the GFP-Puro cassette. Three double stranded breaks are necessary...necessary for knock-in: one on either side of the GFP-Puro cassette and one in between the 5’ and 3’ microhomologies...microhomologies (5’ and 3’) to anneal, knocking the GFP-Puro cassette into the locus (see figure below). The ...overview of PITCh. The PITCh plasmid contains a GFP-Puro cassette flanked by 5' and 3' microhomology and ...bp 5’ and 3’ microhomologies are added to the GFP-Puro cassette via PCR, and this construct is inserted...

...most request plasmid in 2016 was... pSpCas9(BB)-2A-Puro (PX459) V2.0       Similar to last year, the top...the 5'NGG3' PAM sequence as directed by a gRNA. 2A-Puro In this plasmid, SpCas9 is fused to the puromycin.... V2.0 This designation separates pSpCas9(BB)-2A-Puro (PX459) V2.0 from it's predecessor, which had a ...mutation has been corrected in V2.0. pSpCas9(BB)-2A-Puro (PX459) V2.0: What's not in the name? Not included...

...-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro: Expression...pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro) are also in the works...protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 ORF3a Lentiviral ...

...empty backbones for shRNA expression, such as pLKO.1 puro and pLKO.1 – TRC cloning vector. Lentiviral Plasmids...negative control, and empty backbones such as pBABE-puro for retroviral expression and pLVTHM, a lentiviral...

... expression.  Cloning and expressing RNAi pMKO.1 puro (Plasmid #8452) RNA interference (RNAi) is an RNA-mediated...Vectors    Expressing your gene of interest pLenti-puro (Plasmid #39481) You can clone your gene of interest...

...into pAG Lenti CMV N-HA Puro (Addgene #236079) to create pAG Lenti CMV HA-EGFP Puro (Addgene #236081), then...

...and carry the metallothionein promoter (e.g. pMT-puro). Worm vectors There are several approaches to studying...

... by another vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre is coexpressed with tdTomato and Pac (...from the CB promoter pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance... FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance... gene from the EF1 promoter pCDH-CMV-mCherry-T2A-Puro 72264 Express mCherry and puromycin resistance gene...increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter...the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 Expresses Nluc and copGFP from the EF1 promoter...from the EF1 promoter pCDH-EF1s-Nluc-P2A-copGFP-T2A-Puro 73032 Expresses Nluc and copGFP from a truncated...

... if you need to. Additionally, they have an IRES-Puro marker to facilitate stable cell clone selection...

...second vector that delivers gRNA, such as lentiGuide-Puro. The alternative single-vector systems typically...

...ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puromycin...Christophe Benoist and Diane Mathis 21915 Tet-pLKO-puro 3rd Inducible expression of shRNA with puromycin...for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive...for additional variants. Eric Campeau 39481 pLenti-puro 3rd CMV-driven expression of cDNA with puromycin...selection markers. Tobias Meyer 86849 pBOB-EF1-FastFUCCI-Puro 3rd Encodes FUCCI reporters for cell cycle analysis... Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and...additional variants. David Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer...

...GFP, as seen in blue flame plasmid OCT4-eGFP-PGK-Puro from the Jaenisch lab.   Figure 3: A knockout...

...47916 pRXTN CMV/MSV A modified version of pRX-tight Puro encoding NAT instead of PAC. James Iglehart 20672...with a GFP marker. Tannishtha Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid) MSCV For cloning and gene...GFP. David Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid. Deletion...

...library Brunello in lentiGuide-Puro Human sgRNA library in backbone lentiGuide-Puro targeting 19,114 genes and...library Brie in lentiGuide-Puro Mouse sgRNA library in backbone lentiGuide-Puro containing 78,637 unique...

...vectors (for lentiviral packaging) and contain an IRES-Puro marker for stable cell clone selection. For more...

...expression, we could use a vector like pLenti CMV Puro DEST (w118-1) or the doxycycline-inducible pLIX_...

...pMSCV-IRES-YFP II IRES Retroviral pCMMP-MCS-IRES-Puro IRES Retroviral pEF1a-IRES-Neo IRES Mammalian ...

...Description Transactivator Promoter PI 21915 Tet-pLKO-puro Lentiviral Tet-On plasmid for inducible expression...TetR H1-2O2 Dmitri Wiederschain 85966 EZ-Tet-pLKO-Puro Lentiviral Tet-On plasmid for easier cloning and... TetR H1-2O2 Cindy Miranti 104321 tet-pLKO-sgRNA-puro Lentiviral Tet-On plasmid for inducible expression...Tet-On 3G rtTA TRE3GS Xiaojun Lian 171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression...for CRISPRa Emma Rawlins 72835 pMK243 (Tet-OsTIR1-PURO) Expresses OsTIR1 under the control of a TRE3GS ...

...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...