We narrowed to 3 results for: puro
-
TypeGuide... as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer...
-
Gamma-Retroviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
Lentiviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...