We narrowed to 3 results for: puro
-
TypeGuide...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus...
-
Gamma-Retroviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
Lentiviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...