We narrowed to 1,019 results for: REN
-
TypeBlog Post... are composed of many different gRNA-containing plasmids, each with a different genomic target. The goal...1. What species are your cells derived from? Currently, Addgene carries CRISPR libraries that target ...genome, or a specific class of genes? Addgene currently carries several genome-wide CRISPR libraries and...cell or set of cells containing a mutation in a different gene. Libraries may be available in a 1-plasmid...multiple replicates and several cell types can strengthen your results. Enrichment or depletion of multiple... out our CRISPR Plasmids and Resources Page. References McDade JR, Waxmonsky NC, Swanson LE, Fan M (2016... for Using Pooled Lentiviral CRISPR Libraries. Current Protocols in Molecular Biology 115: . https://doi.org...
-
Transferable Skills Guide: Identifying Your Transferable Skills
TypeBlog Post...social life and rest. I need it just as much in my current role as Customer Support and Operations Manager...and projects. It is crucial to identify these strengths within yourself, and to demonstrate them to the...collaboration and fail to identify it as a personal strength until it is identified by another person. Similar...situations where you can learn more about possible strengths and weaknesses, and view everything as a learning...naturally to you. How is this new opportunity much different? Might you already have leadership skills that...solution to the person over email. Examine your current and past job descriptions. Scan through all the...piece of paper and list all the skills that your current or past job requires day-to-day, and you’ll get... -
Getting to Know Expansion Microscopy
TypeBlog Post...the integrity of different targets and labels. You may want to check out a few different protocols to look...you’ve been looking for too! References and resources References Bertiaux E, Balestra AC, Bournonville... two points within ~250 nm of each other. For reference, individual presynaptic terminals, which are jam...optically magnify quite so much. Created with biorender.com Steps 2-4 are not found in standard IHC/ICC...traditional full IgG secondaries, can improve signal strength (Sherry and Stiles, 2022). Fourth, signal continuity...2020). Plus, it’s been demonstrated to work in different model systems, paired with SRM techniques, and... -
Plasmids 101: Colony PCR
TypeBlog Post...created with the same backbone but that contain different inserts. When you design primers to anneal outside...primer pair to screen for the presence of many different inserts. The downside: this type of primer does... The type of primers you use depends on your preferences. Either way, make sure to test your colony PCR...a standard PCR thermocycling program. One key difference is the plasmid DNA must be released from the ...and without an insert. These controls are quick references you can use when you run your PCR products out... an appropriate molecular weight standard for reference and to add a loading dye with glycerol to your...products have any mutations. There are lots of different cloning strategies, but regardless of which is... -
Twenty Years of Sharing: Expanding Accessibility
TypeBlog Post..., many plasmids were available, but they often weren’t easily accessible, due to a wide range of logistical...world. This idea, that available and accessible weren’t always the same thing, shaped both Addgene’s founding...distributor for that country. In China, direct shipments weren’t able to clear import control. Partnering with a...form of problem-solving. When universal solutions aren’t enough to ensure accessibility, partnering with...particular topic into beautifully designed and easy-to-reference eBooks. Figure 3: Global readership of the Addgene...which received over two million views from 119 different countries (Figure 4). Four of the five most popular...researchers who use them. The best part of any conference is scientists, from techs to grad students to... -
Getting the Most from Your Lentiviral Transduction
TypeBlog Post...be translated to other lines. Differences in the physiology of different cell types, however, can make...not only between serum from different manufacturers but also between different lots of serum from the same...concentrated dilutions you will be able to overcome differences in receptor expression. It's all in the mix Even...typically employ the positively charged polycation, polybrene. Interestingly, one study found that alternative...Virus? Check out Addgene's New Viral Service! References 1. Hay, R.J., Macy, M.L. & Chen, T.R. “Mycoplasma...tropism of lentiviral vectors through pseudotyping.” Current Gene Therapy 5.4 (2005). 387-98. Pubmed PMID: 16101513... -
IBEX Knowledge-Base: A Data Resource for Multiplex Tissue Imaging
TypeBlog Post...shared ownership. Go check it out! References and Resources References Radtke, A. J., Chu, C. J., Yaniv,...mean highly multiplexed: you can image over 65 different parameters using this method (see Movie S8 from...for spatial biology enthusiasts. This dataset currently includes 1049 community-validated reagents from...fluorescent probes, representing imaging from 47 different tissues. Researchers upload and share both their...resources .csv file for easy filtering and sorting. Reference images can be viewed by clicking on the links ...data, more discussion, and more functionality. Transparency, both in what works and in what doesn’t, and... -
Promoters
TypeGuide... Plasmid Reference Molecular Biology Reference Promoters Promoters Definition A promoter is...Addgene's molecular biology reference material covering promoters, transcription and the transcription...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Operons Although bacterial...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter... types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes encoding... -
Deep Mutational Scanning with One Pot Saturation Mutagenesis
TypeBlog Post...works well to generate libraries, they all have inherent shortcomings compared to one pot saturation mutagenesis... and scalability (see Supplementary Table 1 of Wrenbeck et al). It uses a uracil labeled wild-type ssDNA... saturation mutagenesis technique described in Wrenbeck et al is a PCR-based approach for generating a...264 basepairs, was the maximum length tested by Wrenbeck et al but it’s likely that longer stretches of...of positive clones. See Supplementary Note 1 in Wrenbeck et al for details on how nicking was optimized...mutagenesis? How would you use it in your research? References 1. Natarajan, Chandrasekhar, et al. "Epistasis...Protocols, pg. 103-109. PubMed PMID: 20676978. 3. Wrenbeck, Emily E., Justin R. Klesmith, James A. Stapleton... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...construct containing fluorescent proteins (XFP) of different colors to label an organ or entire organism. Because...localization sequence, allowing it to localize to a different area of the cell than CFP and YFP. The most recent...could recombine to activate the expression of a different fluorescent protein. Therefore, each cell could...Confetti mouse was first used to describe the self-renewal of cells in the intestinal crypt, and since then...proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018) overcame...method that makes tissues, such as the brain, transparent so that the 3D architecture of a fluorescent ...can be combined with new imaging techniques. References Cai, Dawen, et al. "Improved tools for the Brainbow... -
New Optogenetic Tools for Cytoskeleton and Membrane Control
TypeBlog Post...of interest supports a variety of processes in different cell types. One great way to do this is to use...model for optogenetic studies since they are transparent and the developing embryo is accessible for injection...SuperPLD module is optogenetically recruited by different CIB constructs to the plasma membrane or lysosomes...future updates to the collection! Resources and references Additional resources on the Addgene blog Viral....org Optogenetics Guide Optogenetics Plasmids References Aljiboury, A. A., Ingram, E., Krishnan, N., Ononiwu...precise control over vascular endothelial barrier strength. eLife, 12, RP84364. https://doi.org/10.7554/eLife...optogenetic tool for localized, microtubule disassembly. Current Biology, 32(21), 4660-4674.e6. https://doi.org/... -
Using Phosphoserine to Study Protein Phosphorylation
TypeBlog Post...however different proteins will likely achieve different levels of incorporation due to differences in stability... further technical reference and protocols for use of this system, please reference ‘Rinehart Lab reagents...tools such as phosphospecific antibodies, which aren’t available for the majority of documented phosphorylation... length of induction, which will vary between different proteins. Beyond these standard considerations...mitochondrion. You can follow her on Twitter @nieminm. References 1. Cohen, Philip. "The origins of protein phosphorylation... -
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post...hard to count the number of different commercial strains of E. coli currently available – a quick Google...the intestinal tract of animals. There are many different naturally occurring strains of E. coli, some of...more convoluted due to researchers sharing and renaming samples throughout history. It was likely isolated...tetracycline Additionally, Table 2 provides a quick reference for some of the popular strains, their genotypes...lacZΔM15] hsdR17(rK-mK+) MC1061 Streptomycin Parent of DH10B/TOP10 and derived strains, common lab ... has a great list of genetic markers for your reference. Browse Addgene's curated list of Bacterial Expression... Matthew Ferenc... -
Early Career Researcher Toolbox: Free Tools for Making Scientific Graphics
TypeBlog Post... to use pre-drawn images in your figures Biorender Biorender is like clip art for scientists. The web-...guarantee Biorender will create it. Additionally, you can upload your own images to the Biorender workspace...workspace. Free Biorender accounts can store 5 workspaces at a time and workspaces are only downloadable in...in a small file size with a Biorender watermark, which is usually ok for informal settings like lab meeting... paid account. I’m proud to announce that @BioRender (a project my team & I have poured our hearts ... -
Antibodies 101: Fc Effector Functions
TypeBlog Post...subclass, and are part of the reason why different isotypes drive different types of immune responses. Handily... do so much more than that! References and resources References Clynes RA, Towers TL, Presta LG, ...immune cells. (psst! Need a quick review of the different immune responses? We got you! You can also review...receptors; and so on and so forth. There are a lot of different receptors, but their downstream effects can be...region contributes to affinity and specificity. Trends in Immunology, 29(2), 91–97. https://doi.org/10.1016... -
Networking and Inspiring Young Scientists at Freshers Fairs
TypeBlog Post...Laureates, who speak about their work and current, trending topics in their area of research. The society...students with their applications. The society currently has 1,283 members, who comprise undergraduates...students who want to study chemistry. The society currently has 352 members, ranging from undergrad all the...Biological Society based at the University of Oxford currently has around 700 members and hosts a range of scientific...provides talks and career support for a range of different scientific disciplines, as well as social and ...members as well as arranging collaborations and conferences for their students. Another large goal of the... -
Sequencing Primers
TypeGuide... Plasmid Reference Molecular Biology Reference Sequencing Primers Sequencing Primers...convenience. For reference information, please consult Addgene's Molecular Biology Reference Page . All listed...sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing... hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC... -
Is this the right place for me? 8 tactics for choosing a lab
TypeBlog Post...something you CAN choose and it will make a huge difference for your future career and life. You might see...amazing scientists, but the labs were profoundly different. My first rotation was with a mid-sized lab with...hone in on the factors that will make the most difference for your success. Gather data on the lab choices...? What is the energy level in the lab? Does a frenetic atmosphere make you edgy or energized? Are you...used to a lot of attention? Or are you one of 8 children and used to getting the attention you need? Are...your best performance and learning? Everyone’s different so give some thought to what atmosphere makes ...lifelong learners. I believe we won’t be happy if we aren’t learning so before you take any position you must... -
Plasmids 101: Dimers and Multimers
TypeBlog Post...plasmid sample has a mix of different-sized multimers, you may even see different sets of bands on the gel... us at [email protected]. Resources and References References Bacolla A, Wang G, Jain A, Chuzhanova NA...multimerization has been observed to occur in many different kinds of plasmids, taking many forms (Levene, ...from BiteSize Bio for more information on how different plasmid conformations run on an agarose gel). ... tips. Portions of this figure were made with BioRender. Grow plasmids in recombinase-deficient...Plasmids 101 eBookAddgene's Molecular Biology ReferenceAddgene's Restriction Digest Protocol More resources... -
FPbase: A new community-editable fluorescent protein database
TypeBlog Post...view previous versions. Currently, all submissions also require a DOI referencing primary literature, and...the time) began an effort to collate some of the current “best” FPs, and I collaborated with him on a web-based...that one might like to store about FPs than is currently represented at fpvis (complete spectral information...sequences and lineages, FRET efficiencies, additional references, etc...) and a more robust database structure...address). One may also simply attach important references that serve to further characterize a protein ...plenty of room for improvement and elaboration. Current projects include incorporation of biosensors, protein... -
Visualizing Genomic Loci with CRISPR-Sirius
TypeBlog Post...cells (Ma et al., 2015). To do so, they fused a different fluorescent protein to various Cas9 variants, ...either MS2, PP7, or boxB) that each recruits a different fluorescent protein (BFP, GFP, or RFP) to the ...green, or red readout. But gRNAs containing two different hairpins will produce a secondary color (yellow...allows for simultaneous visualization of sites on different chromosomes in living cells, the system requires...they chose an intergenic DNA region (IDR3) as a reference loci to measure inter-locus distances of loci ...sgRNA-Sirius-4X(MS2-PP7) showing recruitment of different fluorescent proteins. (B) CRISPR-Sirius used to...try. Find CRISPR-Sirius plasmids at Addgene. References Ma, Hanhui et al. “Multicolor CRISPR labeling... -
Summer SciComm Series: A PhD in Science Communication
TypeBlog Post...efficacy of different materials so that we could have discussions about the pros and cons of different fabrics...about the difference between airborne and aerosolised droplet transmission and how different fabrics and...sexual and reproductive health. References and Resources References Drummond, C., & Fischhoff, B. (2017...used to stay up past my bedtime, poring over my grandparents’ medical textbooks by torchlight under the covers... -
Plasmids 101: Gram Negative and Positive Bacteria
TypeBlog Post...in 1983. The differences between gram positive and negative bacteria is due to differences in cell wall...minoring in studio arts photography. References and resources References Silhavy, TJ., Kahne, D. & Walker ...negative and positive bacteria are permeable to different classes of antibiotics. The classification system...system is incredibly helpful in visualizing differentiations between bacteria, leading to safer medicine...diagnostics/22612-gram-stain Hardy, J. Gram’s Serendipitous Stain. https://hardydiagnostics.com/wp-content... -
Screening for Successful Genome Editing with Digital PCR
TypeBlog Post...desired mutations. The assays you will use aren’t that much different from conventional duplexed primer probe...mutation of your favourite gene, there are several different methods available. Thankfully, there are many ...primer to amplify the target locus, as well as a reference probe designed to bind at an unedited site distal...are completely “blind” to this very important difference (Figure 3). If you are interested in harnessing... mutations be out of frame! Scott Findlay is currently a Postdoctoral Fellow at the University of Alberta...biology. Follow him on Twitter @AnotherLabRat. References 1. Miyaoka, Y. et al. Isolation of single-base... -
AAV Q&A with Tim Miles
TypeBlog Post... the best method for titering AAV? Is there a difference in titer results between ddPCR and qPCR? A: At...curve and somewhat more reliable quantitation. Differences in sample treatment across methods can affect... Q5: What is the efficiency of co-delivering different AAV particles into the same cells in vivo? A: ...give some insight into codelivery efficiency at different doses. See Figure 4 in this paper for more information...epithelial cells of the blood brain barrier we would currently recommend PHP.V1 or AAV-BR1. We recommend you ...IACUC committee. Animal Models Q9: Is there any difference in transfection efficiency when delivering these...injections? A: We have not observed any appreciable difference in AAV transduction efficiency between retro-... -
CasPEDIA: A Functional Classification of Cas Enzymes
TypeBlog Post...new features to the tool. Resources and References References Adler, B., Trinidad, M., Bellieny-Rabelo...CasID, to help facilitate direct comparison of different enzymes. CasPEDIA is meant to be a constantly ...plasmids containing that enzyme, and embedded in the References lists on every page you can find direct links...design, etc.). With this feature, you can compare different Cas enzymes to make sure you are getting the desired...the winner!). Fig. 3 – Comparison of different Cas enzymes using CasPEDIA. Adapted from Adler...Phylogeny tool allows users to browse entries by the current phylogenetic nomenclature and discover orthologs... -
Viral Vectors 101: Viral Vector Elements
TypeBlog Post...discussed are compiled for reference below. Happy virus making! References and Resources Kulanayake,...promoter and terminator regions and are slightly different in sequence. Both LTRs do share common repeat ...there are bonus components to these vectors that aren’t reflected in the common components outlined above...Adeno-associated virus AAV’s elements are quite different from gamma-retrovirus, but they perform very similar...which allows for altered tropism of AAV to target different tissue or cell types. AAV also requires some back...will outline the common features as well as the differences within their viral elements. Gene expression ... -
GCE4All: Making Genetic Code Expansion Accessible
TypeBlog Post...spread the word as new protocols come out! References Noren, C. J., Anthony-Cahill, S. J., Griffith, M...incorporation of an unnatural amino acid in translation (Noren et al., 1989). In the late nineties, this was developed... But this focus on development, along with the inherent trickiness of using and optimizing GCE, led to...site-directed mutagenesis, many researchers new to GCE aren’t able to successfully complete their experiments...uncommon to find protocols that require reagents which aren’t broadly or easily available, so you may find yourself... they’d also love scientist interested in, or currently using, GCE to reach out to them and let them know... -
Antibodies 101: Monoclonal Antibodies
TypeBlog Post...for your experimental needs. References and resources References Bradbury ARM, Trinklein ND, Thie ...experiments, you may be curious about all of the different kinds of antibodies that are available. One common...monoclonal antibody production. Image created with BioRender.com. The antibody-producing B cells that are...heterogenous mixture of antibodies that recognize many different epitopes on the same protein - are more likely...impacts the specificity, avidity, and number of different antibodies produced by the hybridoma. Image from... Trimmer JS, Görnemann J, Glanville J, Wolf P, Frenzel A, Wong J, Koh XY, Eng H-Y, Lane D, Lefranc M-P... -
Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers
TypeBlog Post... actually surprising to us that there aren’t a hundred different versions of this out there. Addgene: ...Addgene. For more details on the plasmids that are currently available along with detailed protocols, go to...and it’s already looking like it’s making a big difference. We can now look at many more transcription factors... this for tagging any protein in all kinds of different assays, not just transcription factors. The second...cells. It was made artificially. That means you aren’t getting any background or cross-reacting. We’ve... They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any additional tips... -
Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)
TypeBlog Post...use temperature to denature and renature the dsDNA. Upon renaturation, you will generate DNA duplexes ...at how variable Cas9-expression was across the different cells (Figure 3). Figure 2: Cas9 expression...publication. Pro-Tip: 1. Use multiple gRNAs to target different regions of your gene. I used existing BRAF gRNA...our website. There are a few reasons to target different regions of the gene with multiple gRNAs, but the...comparing the phenotypes of multiple gRNAs. Targeting different regions of the gene is also useful in case the...that would co-migrate on a gel) instead of two different sized digestion products (which could be easier...your way to making new scientific observations. References 1. Rago C, Vogelstein B, Bunz F. Genetic knockouts... -
When Fidelity Matters: A frank discussion about ligase fidelity
TypeBlog Post... probes, LDR can reliably detect single-base differences. The original creators of this technique visualized.... The structural/mechanistic reason for this differential is not known for certain, but may have to do...Sixteen separate pools were prepared, each with a different complement strand covering all 16 possible NN ...each possible pairing resulted in a product of a different length, with products identifiable and quantifiable... in the enzymology of DNA repair enzymes. References 1. Shuman, Stewart, and Christopher D. Lima. ...superfamily of covalent nucleotidyltransferases." Current opinion in structural biology 14.6 (2004): 757-...PMC4737175. 22. Liu, Pingfang, Artur Burdzy, and Lawrence C. Sowers. "DNA ligases ensure fidelity by interrogating... -
Finding Your Science Policy Path
TypeBlog Post... away from the bench, I have worked for seven different organizations in a variety of science policy roles...opportunities. But even through all my roles and my current work as a AAAS Science and Technology Policy Fellow...cultural, and political. Science policy looks differently depending on how and where you pursue it. It ...Action Items: Start a career journal during your current job and note what makes your heart sing, what makes...information may help you determine what parts of your current job you want to keep or change and can inform your...you do science policy? Just like there are many different types of science policy careers, there are many...NSPN maintains a great resource guide including conferences, societies, and outreach groups. Grab a virtual... -
A History of Genome Engineering in Popular Culture
TypeBlog Post...perspective of the current. Although genome editing technologies have brought a renaissance in the field of...fiction, was also a trained biologist. This is apparent in his work The Island of Dr. Moreau (1896) where...In the 1960s, Har Gobind Khorana, Marshall W. Nirenberg, and Robert W. Holley cracked the genetic code...TALENs more specificity and a broader substrate preference than the ZFNs. Genetic Engineering Era: Post...also transcended into the world of SciFi. This is apparent in the use of the word ‘CRISPR’ for anything associated...your research Browse plasmids for base editing References Anzalone AV, Randolph PB, Davis JR, Sousa AA,...pangenesis to the rediscovery of Mendel. Comptes Rendus de l’Académie des Sciences - Series III - Sciences... -
Stabilized Bacterial Promoters: Constant Gene Expression at any Copy Number
TypeBlog Post...were also tested in different plasmid backbones that varied in size or carried different genes. In these ...promoters incorporate feedback loops such as the incoherent feedforward loop (iFFL). In general, iFFLs use...number. Moreover, gene copy number is affected differently by growth rates when a gene is expressed from...Segall-Shapiro et al. showed nearly no position-dependent differences in gene expression. On the other hand, slow growth...promoters can eliminate variability between the different components. When your pathway needs precise fine-tuning...levels, give these stabilized promoters a try. References 1. Segall-Shapiro, Thomas H., Eduardo D. Sontag... -
Antibodies 101: Secondary Antibodies
TypeBlog Post... hand and use them to easily test different antibodies or different signaling molecules. Many labs find...proteins are represented in orange. Created with BioRender.com. How do secondary antibodies work? ...are readily available conjugated to a number of different signaling molecules. With the direct approach,...possible, or ensure that the primary antibodies are different species and/or isotypes. For highly multiplexed...has introduced new options for increasing signal strength. For the time being, though, secondary antibodies...generated in goat against rabbit immunoglobulins. References and Resources More resources on Addgene’s blog... -
Viral Vectors 101: An Introduction to AAV
TypeBlog Post... the retina using viral tools. References and Resources References Pillay, S., et al. "An essential ...and can be specifically targeted to a number of different cell types even when systemically administered...capsids allow the virus to infect (or not infect) different cell types with some specificity. There are a ...will lose expression quicker than terminally differentiated, non-dividing cells. Figure 2: ...Goz Ayturk with edits and updates from Addgenies Karen Guerin and Susanna Stroik. Didem Goz Ayturk is a...subretinal injections of neonatal mouse eyes at two different ages." Retinal Degenerative Diseases. Springer... -
The Future of Research Symposium Boston 2015
TypeBlog Post... What are the current numbers of trainees? Are there too few or too many at different levels? What does...generating too many trainees per PI” “Lack of awareness about how the system operates and functions” “...and outside of academic research (4). There are currently 17 sites around the USA undertaking BEST programs...a young scientist’s perspective, and the many different paths that biomedical graduates take in their ...policy. Follow David on Twitter @driglar. References 1. Alberts, Bruce, et al. "Rescuing US biomedical...Henry, and Michael Roach. "Science PhD career preferences: levels, changes, and advisor encouragement."... -
Career Coaching for Scientists: Why and Where Do I Find One?
TypeBlog Post...wish to improve their current job situation. What can a coach do that is different from an adviser, boss... transition out of the academic sphere into a different meaningful career in science. Supervisors in the...speaking at research institutions and at scientific conferences, I see that few scientists are aware of the benefits...few hours of coaching time can make an enormous difference so don’t assume that this will cost a fortune...specializes in scientist coaching. Always ask for references and follow up with 3-4 to hear about those clients...also a very popular speaker and workshop leader. Lauren Celano of Propel Careers is not a professional ... -
Working with Nuclear Receptors
TypeBlog Post...than 300 different coactivator proteins individually contribute to cell regulation in a coherent manner.... one of the most successful targets for drugs currently available or being developed to treat a multitude...patterns of nuclear receptors across multiple different tissues in normal and disease states, their circadian...previously uncharacterized cellular roles. In the current phase of NURSA we are seeking to compliment these...our data mining tool, Transcriptomine. We are currently nearing the completion of an 18-month effort to...found in the Datasets and Reagents sections of the current NURSA website. NURSA and Addgene The great progress...