We narrowed to 188 results for: phen

...express differently in different mouse strains, a phenomenon that we are calling “strain-specific tropism....

...stem cells (iPSCs) to take on a “neuron-like” phenotype when targeting genes involved in neurogenesis,...

...previously unknown genes that contribute to a phenotype. Pooled libraries consist of a single mixture ...understand what genes are important to a certain phenotype, and allow you to design additional hypothesis-directed...perturbations, and linking perturbations to single-cell phenotypes. These libraries are also commonly used to monitor... of mutant cells that are then screened for a phenotype of interest. Screening experiments using a pooled...technique that physically links a protein's function (phenotype) to the gene that encodes it (genotype). This ...chromatin accessibility Direct gain-of-function phenotypes Limitations Non-physiological expression Cannot...screening to elucidate which genes are involved in a phenotype. They are also useful for drug resistance screens...

... Genetics The concept of genes as carriers of phenotypic information was introduced in the early 19th ...multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer to the amino acid table...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin... Lysine Lys K AAA, AAG Methionine Met M AUG Phenylalanine Phe F UUU, UUC Proline Pro P CCU, CCC, CCA, ...

...targeted gene. However, the strength of the knockout phenotype for a given mutant cell must be validated experimentally... (often called hits) that result in a desired phenotype. The ease of gRNA design and synthesis, as well...to screen for novel genes that regulate known phenotypes, including resistances to chemotherapy drugs ...

...organisms. TALEN Kit Genome Engineering, TALEN Stephen Ekker 256 plasmids encoding all possible combinations... Assembly System Kit Genome Engineering, TALEN Stephen Ekker 336 plasmids of pre-assembled pFusX clones...

...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...

...surveying a pool of genetic mutants for various phenotypes. These screens involve hundreds to even thousands...