Skip to main content

We narrowed to 6 results for: phen

Showing: 1 - 6 of 6 results
  1. Molecular Biology Reference

    Type
    Guide
    ... Genetics The concept of genes as carriers of phenotypic information was introduced in the early 19th ...multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer to the amino acid table...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin... Lysine Lys K AAA, AAG Methionine Met M AUG Phenylalanine Phe F UUU, UUC Proline Pro P CCU, CCC, CCA, ...
  2. Guide to Using Pooled Libraries

    Type
    Guide
    ...previously unknown genes that contribute to a phenotype. At their simplest level, pooled libraries are...understand what genes are important to a certain phenotype, and allow you to design additional hypothesis-directed...screen employ a selection method relevant to the phenotype being studied. Examples of published selection...
  3. CRISPR Guide

    Type
    Guide
    ...targeted gene. However, the strength of the knockout phenotype for a given mutant cell must be validated experimentally... (often called hits) that result in a desired phenotype. The ease of gRNA design and synthesis, as well...to screen for novel genes that regulate known phenotypes, including resistances to chemotherapy drugs ...
  4. Modular Cloning Guide

    Type
    Guide
    ...organisms. TALEN Kit Genome Engineering, TALEN Stephen Ekker 256 plasmids encoding all possible combinations... Assembly System Kit Genome Engineering, TALEN Stephen Ekker 336 plasmids of pre-assembled pFusX clones...
  5. Sequencing Primers

    Type
    Guide
    ...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...
  6. Lentiviral Vector Guide

    Type
    Guide
    ...surveying a pool of genetic mutants for various phenotypes. These screens involve hundreds to even thousands...
Showing: 1 - 6 of 6 results