We narrowed to 1,060 results for: FER

...antibodies are all of different species/isotypes and that each secondary has a different color fluorophore...a comment below. Happy imaging! References and Resources References Andrews, N. P., Boeckman, J. X., ...be familiar with immunofluorescence (IF, often referred to as immunocytochemistry (ICC) when the sample...mixture of secondary antibodies, and image all the different colors in one session – fast and easy! Just make...Trimmer Lab, using recombinant antibodies with different isotypes. (A) Neocortex labeled with anti-pan-...make sure you are using primary antibodies from different species or isotypes, so that the secondary antibodies...to align the images of each labeled target as different color channels and analyze the results. Depending...

...looking at a bunch of different strategies with CRISPR-Cas9. There are so many different variants and strategies...will help them to understand how different mutations lead to differences in the symptoms experienced by ...competition for researchers working on rare diseases, offering them the chance to win some of the latest tools...with the condition to reveal some “outstanding differences.” They now have some theories on the underlying...had the opportunity to meet a few patients that suffered this disease,” Aguilar said. “Once you have that...Institute and Addgene will make a substantial difference in pushing the work forward. Xeroderma Pigmentosum...lot of those plasmids so that we can try many different things in parallel.” Alternating Hemiplegia of...

...demonstrated that different deaminase and UNG enzymes had different sequence preferences, which they defined...outcomes of their various CGBEs at different target sequences and in different cell types, available at www....non-target strand.” To avoid confusion, we usually use different terminology when discussing base editors, like...up to 68% at the most favorable target sites. Differential cytosine editing between bacteria and mammalian...sites. But the same strategy in E. coli produced different results. GBEs seemed to follow the same initial...editors Now that several labs had shown that preferential C → G editing was possible, the race was on ...creating BE variants with other Cas9s that recognize different PAMs. Their computational tool for predicting ...

... with a T-DNA (transfer-DNA) region. During infection this T-DNA region is transferred into the plant....track, we switched to luciferases to more easily quantify the effect of the different treatments on transformation...method. Transfer your plant into the dark 16 hours before the transformation. We routinely transfer our plants...the T-DNA region with the gene of interest is transferred into the cells. But for C. roseus, Agrobacterium... lot of time. Don't re-invent the wheel. Test different leaf ages Usually younger leaves work better. ...GUS::tMAS to confirm transformation success. Luciferases are great quantitative reporters and use a substrate...substrate to produce bioluminescence. Luciferases usually have shorter mRNA and protein half-lives then...

...applicable to the rat [6]. Technical differences include the ferrule implants and patch cables. One huge...intracranial self-stimulation (ICSS) and place preference. The lab I work in (the Kreek lab) focuses on...behaviors to test reinforcement are ICSS and place preference.   Historically, ICSS was done by implanting ...nose-poke at the active hole [1, 2].    Place preference/place aversion also models reinforcement but ...halves that are distinguished visually through different patterns and the animal only receives stimulation...). If a circuit is reinforcing, the animal will prefer to spend most of its time in the chamber in which...Comparison of c-fos amongst animals that receive different types of stimulation may help to refine and optimize...

... transposition.  Target site: Different transposons insert at different DNA sequences or target sites....has several different applications (mutagenesis screens, transgenic animals, gene transfer). The discovery...specific locations in the genome.   References and Resources References Feschotte C, Pritham EJ (2007) DNA...commonly used in the lab While there are many different types of transposons, DNA transposons are most... vectors.   Let’s take a closer look at three different transposon systems adapted for use as research...Sandoval-Villegas et al., 2021). Sleeping Beauty’s preferred target site for integration is TA dinucleotides...piggyBac, Tol2 has a weak consensus sequence for its preferred target integration site: TNA(C/G)TTATAA(G/C)TNA...

...destroy and remove a pathogen. Different isotypes also appear at different stages of an immune response..... Some isotypes have different versions or subclasses that have minor differences in their heavy chain...new Isotype trading cards!     References and resources References Janeway CA Jr, Travers P, Walport...express receptors that recognize the Fc portion of different antibody isotypes. Binding to complement system...that transport antibodies through cells and into different body compartments, such as into mucus, tears, ...Western blotting.  The five isotypes of antibodies Differences in their heavy chain constant regions result ... However, when B cells switch to expressing a different isotype, the intervening DNA sequence is deleted...

...conjugated to different fluorophores or a panel of primaries that was raised in different species or are...are complex and antibodies may perform differently in different samples and experimental conditions. Be...for IHC, not all IHC experiments are the same. Differences in sample processing, fixation, antigen-retrieval...make sure that you can easily distinguish each different type of antibody and therefore each target protein...unique isotype or species, then you can choose different fluorophore-conjugated secondary antibodies specific...that has been cited thousands of times may be a safer bet than one that has never been used in a publication... and knowledgeable technical support team, is a safer bet than one from a large distributor that may not...

...find lots of different plasmids containing the same protein of interest tagged with different fusion proteins...you the flexibility to choose different colors or ligands for different experiments without having to ...intracellular recordings, switching between different colored ligands at different time points.   Figure 3...or HaloTag have been shown to perform differently for different ligands (Wilhelm et al., 2021). While ...up for your next experiments!   References and resources References Bottanelli, F., Kromann, E. B., Allgeyer...proteins for different experiments over the years — a green fluorescent protein, a red fluorescent protein... Combining orthogonal self-labeling tags on different proteins of interest (or one self-labeling tag...

...by Promega scientists here.  References and resources References Hall, M. P., Unch, J., Binkowski,....67.1.509  More resources from Addgene Luciferase 101 Luciferase Plasmid Collection Promega Plasmid Collection...partner LgBiT, reconstitutes a fully functional luciferase enzyme (Figure 1). Addition of substrate generates... al., 2018). The small size of HiBiT reduces interference with the native function of tagged proteins ... folding or trafficking and their detection can suffer from photobleaching and cellular autofluorescence...and a simple add-mix-measure method. NanoBiT® luciferase activity is compatible with both intra- and extracellular...cells proved that the enzyme was successfully transferred and internalized. Functional assays further showed...

... Educational Resources Molecular Biology Reference Promoters Promoters Prokaryotic Promoters Eukaryotic...mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding strand,...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Figure 2. Basic structure...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter...can drive expression in specific cells or under different conditions. Promoter Expression Species Description... types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes encoding...

...organism. Output diversity: Different tools provide results to the user in different formats. This can have...development CRISPR, like the miRNA bubble before it, offers an interesting view into how rapid innovation affects...the piñata beating party goers are altogether different. They are filled with blind anticipation. Their.... Many tools have also opted to mix-and-match different scoring algorithms and parameters. This tapestry...data input in order to generate results. While different types of input are more user-friendly than others..., this is of less concern than data output as different input types can be readily converted.  Examples...later or share them. Community exclusivity: Different communities develop software for their own needs...

... genetic code is universal, many different organisms actually prefer certain codons over others for certain... (Mauro and Chappell, 2014). Different rates of translation by different tRNAs, including those that exhibit...There are 64 different codons that encode 20 amino acids and three stop codons, meaning that the same...important? Translation and protein synthesis relies on transfer RNAs (tRNAs). tRNAs bind to and deliver amino ...tRNAs that are expressed may be found at very different levels (Mauro and Chappell, 2014). Due to this...that is based on the codon usage frequency in a reference of highly expressed genes (Sharp and Li, 1987)... companies, such as IDT, Genewiz and GenScript, offer tools to help with these decisions.  So when do ...

...middle of proteins) and performs well in many different antibody-based applications.  IPI’s recombinant...recommended for use in western blots (Figure 1). If you prefer to produce your own antibody or want to swap out...virus 5 and their use in revealing antigenic differences between human, canine and simian isolates. J ...early embryogenesis (Figure 3). mScarlet-I3 also offered clearer signals due to reduced background signal...systems don’t always work across species due to differences in natural DNA repair pathways and spontaneous...high rate of spontaneous antibiotic resistance interfering with selection. Using an inducible Cas9 expression...mechanosensor called PILATeS, Pulling-Induced Luciferase Association Tension Sensor (Zhong et al., 2024...

...multiple times and on different days. Using our example above, we would test different preparations of Plasmid...Plasmid A in different aliquots of cells on several different days. Biological replicates control for ...There are many, many different types of experiments carried out by scientists every day. Although the...the plasmid without the independent variable. Referring back to the experiment associated with Figure ...constitutively expresses a reporter protein (e.g., GFP or luciferase) that is either co-transfected with the test ... the results because it provides an important reference point when analyzing the specificity of the shRNA...variable should be consistent over time and from different preparations of the purified test plasmid expressing...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

...findability” of the information on the site. Different users have different strategies for finding what they need...the overall user experience of our website, the different website navigation paths, the organization and...homepage and navigational elements help users who prefer to browse and discover items in our catalog or ...resources through our main dropdown menu. For users who prefer to use search, our updated search engine is now...software team tailored Elasticsearch to support the different usage patterns the larger team identified. The...our catalog of materials and services is quite different from the way it searches through our educational...information in our search indices in order to support different kinds of matches: exact words, partial words, ...

...transgenes in iPSC-derived cells can interfere with their differentiation potential. Finally, retroviruses...reprogramming factors and wait for cells to de-differentiate. However it’s difficult, especially as a newbie...reprogramming proteins. Table 1: Key Features of Different Methods for Generating iPSCs. One important note...reactivation of Myc or other oncogenes after differentiation has been linked to tumor formation in iPSC-...drawback is that lentiviral vectors insert in different genetic locations in each transduced cell, so ...a single polycistronic transgene or with four different adenoviruses, each expressing one factor. These...mutagenesis, adenoviral vectors are considered a safer way to express reprogramming factors for therapeutic...

...components expressed from different plasmid backbones. They noted that backbone differences such as the order,...assess how different lentiviral plasmid backbone elements impact viral titer and to compare different Cas enzymes...Hurt for his expertise and input.  References and resources References Weber, Ernst, et al. “A Modular ...review common uses of MoClo and the kits Addgene offers to kickstart these applications, no matter what...product in an affordable way, researchers test many different combinations of promoters, terminators, solubility... excellent option (Iverson et al., 2016). CIDAR offers a one-pot reaction wherein multi-part assembly ...is at your service (Lee et al., 2015). This kit offers a broad range of parts, including copy number machinery...

...multiple sets of Cas9 mutations that conferred new PAM preferences (Silverstein et al., 2025). In cellular...mutations would need to change to target different mutations in different patients. While these gRNAs would ...to see what you create next!   References and Resources References Cong, L., Ran, F. A., Cox, D., Lin...efficient, and more flexible in their target preferences (Gaudelli et al., 2020; Richter et al., 2020)...CPS1 mutation. Every genetic target is slightly different, so more options mean better chances of identifying...effective. Targeting the right PAM Expanding PAM preferences Base editors can only access a short sequence...experiments, SpG Cas9 came out on top. Narrowing PAM preferences The Kleinstiver lab also worked on the opposite...