Skip to main content

We narrowed to 17 results for: FER

Showing: 1 - 17 of 17 results
  1. Molecular Biology Reference

    Type
    Guide
    ...Educational Resources Molecular Biology Reference Molecular Biology Reference Jump To: Origins of Molecular Genetics...plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity of the genetic...Next-generation Sequencing Long-read Sequencing Reference Tables Additional Resources Plasmids are one of...same amino acid — a phenomenon called degeneracy. Refer to the amino acid table below for codon-amino acid... Joshua Lederberg coined the term plasmid, in reference to any extrachromosomal heritable determinant....bacterium to another by a type of horizontal gene transfer called conjugation. Like chromosomal DNA, plasmid...information about promoters, check out our promoters reference page . Selectable Marker Used to select for cells...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...packaging genes. However, they are different viruses and require different isoforms of these packaging components...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — ...vectors separate transfer, envelope, and packaging components of the virus between different plasmids. The...activate the promoter on the transfer plasmid. Many of the lentiviral transfer plasmids that have been deposited...genes. From an experimental standpoint, the main difference between lentiviruses and gamma-retroviruses is...three (or four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA ...systems, due to a wide range of infectivity for different cell types (known as tropism). Lentiviral vectors...
  3. Antibody Guide

    Type
    Guide
    ... dates. Buffers Buffers are a concern for conjugating and signaling molecules, as some buffer components...heavy chain constant region” or Fc. Different isotypes play different roles in the immune response, and ...removed from the buffer before the reaction. However, it can be added back to buffers after the conjugation...of colors activated by different wavelengths, allowing for easy differentiation between multiple antibodies... In some cases, it may be preferable to buy small aliquots of many different antibodies and do batch validation...an antigen, while the specific binding site is referred to as an epitope. Production Antibodies are typically...typically produced in one of three different methods: in animals, in cultured immune cells, or through...
  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... via a different plasmid. In order to produce rAAV vectors, three plasmids are needed: Transfer plasmid...s Molecular Biology Reference . Production The three production plasmids (transfer, packaging, and helper...2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central...immune response. These features have made AAVs the preferred choice to be used as viral vectors for gene therapy...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or...recombination of unstable regions, like the ITRs found in transfer plasmids. This will ensure that the repeats will...
  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...three different plasmids containing the transfer, envelope, or packaging components. The transfer plasmid...packaging genes. However, they are different viruses and require different isoforms of these packaging components...type. From an experimental standpoint, the main difference between lentiviruses and gamma-retroviruses is...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA ... gene, due to a wide range of infectivity for different cell types (known as tropism). Figure 2: Gamma-retroviral...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or...
  6. Plan Your Experiment

    Type
    Guide
    ...many different Cas proteins available, and researchers can adapt these experiments for different organisms...Desired Genetic Manipulation Different genetic manipulations require different CRISPR components. Selecting...editor variants often have different optimal editing windows. Be sure to refer to the literature associated...Activation/interference Needs good primer design Western blot Knockouts Activation/interference Needs a ...Expression and Delivery Validate Genetic Edit References CRISPR ( C lustered R egularly I nterspaced S...have expanded the CRISPR toolbox to include many different types of edits, including point mutations, base...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused...
  7. Adenovirus Guide

    Type
    Guide
    ... (A to G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain...from different species. Used to alter infectivity and tropism. pShuttle Class of shuttle/transfer vectors.... These genes are now supplied in trans , via different plasmids or the packaging cell line, which not...need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest...recombination between the transfected adenoviral transfer plasmid and the E1 region integrated in the packaging...vectors Third-generation rAdV vectors are also referred to as "gutless" or high capacity AdV (HCAdV) vectors...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...
  8. CRISPR Guide

    Type
    Guide
    ...Alternatives Resources Plan Your Experiment Web References PAM Sequences Glossary Publications CRISPR Overview...techniques . Collectively, these techniques are referred to as CRISPR ( C lustered R egularly I nterspaced...measure of fidelity, so sometimes they will be referred to as increased fidelity enzymes. hfCas9s were...pyrimidine-to-pyrimidine) Base transversions — edit to different classification of nucleotide base (purine-to-pyrimidine...opposite strands Prime editing and base editing both offer high efficiency and low indel formation compared...genetic changes, including moving entire genes to different locations, by combining other gene editing mechanisms...DNA-targeting of CRISPR-Cas systems. You may also see them referred to as INTEGRATE ( I nsertion of T ransposable ...
  9. Chemogenetics Guide

    Type
    Guide
    ...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin) is ...efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native coelenterazine...activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference LMO3 sbGLuc VChR1 CTZ...RASSLs DREADDs PSAMs LMOs Plan Your Experiment References Chemogenetic tools are actuators for specific... of chemogenetic receptors. There are several different types of DREADDs that can be broadly classified...inhibitory KORD DREADD was developed to respond to a different ligand, Salvinorin B (SALB). Scientists have shown...Receptor Effector Ligand Effect Outcome (in neurons) Reference Rq(R165L) Human M3 muscarinic Arrestin-2/-3 CNO...
  10. Optogenetics Guide

    Type
    Guide
    ... Opsins Optical Switches Plan Your Experiment References The field of optogenetics integrates optics and...naturally occurring microbial opsins that respond to different wavelengths of light, like blue or yellow light...light. These various opsins also initiate different electrochemical responses, such as nonspecific cation... blue light activated cation channel. ChR2 is preferred over ChR1 because ChR2 has higher conductance ...optimization, and chimeric fusion of domains from two different ChRs. These ChR variants still function as light-gated...Color of activation light There are a variety of different activation wavelengths, ranging from blue to yellow...rendering the experimental procedure less invasive. Different activation wavelengths also make it possible to...
  11. Promoters

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Promoters Promoters Prokaryotic Promoters Eukaryotic...mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding strand,...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Figure 2. Basic structure...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter...can drive expression in specific cells or under different conditions. Promoter Expression Species Description... types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes encoding...
  12. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...
  13. Guide to Using Pooled Libraries

    Type
    Guide
    ...pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the... library from the Moffat lab has over 175,000 different gRNA-containing plasmids). Amplifying and Using...screen. If you need to amplify the library, please refer to the depositor’s protocol for the best results...conducting pooled library screens. Addgene does not offer next-generation sequencing services. For an NGS ...Genome-Scale, Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens...
  14. Modular Cloning Guide

    Type
    Guide
    ... Molecular Biology Reference Molecular Cloning Techniques MoClo Guide Modular...efficient method for creating many plasmids from different combinations of a common set of components (Weber...reconstituting the ubiquitination cascades of different organisms in E. coli . MetClo DNA Assembly Kit... for creating fusion proteins for use in many different model organisms. Diatom uLoop Assembly Kit Other...including diatoms, yeast, plants and bacteria. References and More Resources Guide to DNA Assembly Techniques...
  15. Molecular Cloning Techniques

    Type
    Guide
    ...Learn about different molecular cloning techniques, focusing on seven common cloning methods....Educational Resources Molecular Biology Reference Molecular Cloning Techniques Molecular Cloning Techniques...availability of starting materials, or just personal preference. Check out our blog on choosing the right cloning... entry , and Gateway destination vectors with different promoters, tags, selection markers, and fluorescent...
  16. Science Guides

    Type
    Guide
    ...Pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the...Find educational guides to learn more about the different types of viruses that are commonly used in research...
  17. Addgene's eBook Collection

    Type
    Guide
    ...Not sure where to start? Need a quick reference? Addgene's eBooks are here to help!...Collection Not sure where to start? Need a quick reference? Addgene's eBooks are here to help! 0 of 0 Selected...and management, resources for identifying your transferable skills, and tips on the job application process...
Showing: 1 - 17 of 17 results