Skip to main content
Addgene

We narrowed to 121 results for: FER

Showing: 1 - 20 of 121 results
  1. Luciferase Plasmid Collection

    Type
    Collection
    ...types of luciferase found in Addgene’s collection are Firefly luciferase (Fluc), Renilla luciferase (Rluc... Plasmid Collections Luciferase Plasmids Luciferase Plasmid Collection You may also like...Fluorescent Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent ...and NanoLuc® Luciferase (Nluc). Luc2 is the second-generation version of Firefly luciferase that has been...mammalian systems. Other luciferases in our collection include Gaussia luciferase (Gluc) and the red and...green Click-beetle luciferases (CBRluc and CBGluc, respectively). Like Firefly luciferase, Click-beetle red...type of luciferase has advantages and disadvantages depending on the application. Firefly luciferase is considerably...
  2. CRISPR References and Information

    Type
    Collection
    ...and references, including gRNA design tools, CRISPR FAQs, and community forums.... CRISPR References and ...and Information CRISPR References and Information Addgene Resources CRISPR Software General Resources CRISPR...kits. CRISPR Software Sanger Indel Analysis ICE (Inference of CRISPR Edits) This open access tool from Synthego...opens in a new window) This tool helps design (10 different prediction scores), clone (primer design), and...inactivation, NHEJ, and HDR. Includes a wide range of reference genomes, including animals, plants, bacteria, ... (CBE) base editors. Includes a wide range of reference genomes, including animals, plants, bacteria, ...
  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8...
  4. Plasmids for Stem Cell Research

    Type
    Collection
    ...cells are proliferative, unspecialized cells with the capacity to differentiate into many different cell types...Research Reprogramming Plasmids Differentiation and Transdifferentiation Plasmids Stem Cell Research Plasmids...can be directly differentiated into specific somatic stem cells or fully differentiated cell types. Browse...collection of Differentiation Plasmids below. Alternatively, it is also possible to directly differentiate one ...one differentiated somatic cell into another via transdifferentiation. This method of cell lineage conversion... of Transdifferentiation Plasmids below. Many of the techniques for reprogramming, differentiation, and... , SOX2 , MYC , KLF4 , LIN28 . Differentiation and Transdifferentiation Plasmids Browse the table below...
  5. Antibody Guide

    Type
    Collection
    ... dates. Buffers Buffers are a concern for conjugating and signaling molecules, as some buffer components...heavy chain constant region” or Fc. Different isotypes play different roles in the immune response, and ...removed from the buffer before the reaction. However, it can be added back to buffers after the conjugation...of colors activated by different wavelengths, allowing for easy differentiation between multiple antibodies... In some cases, it may be preferable to buy small aliquots of many different antibodies and do batch validation...an antigen, while the specific binding site is referred to as an epitope. Production Antibodies are typically...typically produced in one of three different methods: in animals, in cultured immune cells, or through...
  6. Validated gRNA Sequences

    Type
    Collection
    ... 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic GACAGAACGATGCGCTGAAT 68898 interfere S. pyogenes... 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes...AAACAAAACCTCATCAGGCA 68900 interfere S. pyogenes 26918244 Lu PcfiA GAAGCTCACTCCTTAGCACG 68899 interfere S. pyogenes ...74066 interfere S. pyogenes 26829286 Lu pgi C. glutamicum TTGCCTGGAAGTTTGAGTAATGAT 74067 interfere S. pyogenes...74068 interfere S. pyogenes 26829286 Lu pck C. glutamicum TCCAGTTCAGCAGTTCCTTATTCT 74069 interfere S. pyogenes...74070 interfere S. pyogenes 26829286 Lu pyk C. glutamicum ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes.... thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu BT1854 B. thetaiotaomicron...
  7. Lentivirus Plasmids

    Type
    Collection
    ...Addgene lentiviral packaging, envelope, and transfer plasmids...Libraries All Viral Plasmids Packaging Plasmids Transfer Plasmids Lentiviruses, a subset of retroviruses...encodes the viral genome (typically called the transfer plasmid ). This table lists common lentiviral ... Contains Rev; can be used with 3rd generation transfer plasmids along with additional packaging components...Contains Gag and Pol; can be used with 3rd generation transfer plasmids along with a plasmid encoding Rev Trono...and Tat; can be used with 2nd and 3rd generation transfer plasmids Trono 12263 pCMV delta R8.2 2nd Packaging...and Tat; can be used with 2nd and 3rd generation transfer plasmids Trono 12259 pMD2.G N/A Envelope VSV-G-expressing...
  8. CRISPR Guide

    Type
    Collection
    ...Alternatives Resources Plan Your Experiment Web References PAM Sequences Glossary Publications CRISPR Overview...techniques . Collectively, these techniques are referred to as CRISPR ( C lustered R egularly I nterspaced...measure of fidelity, so sometimes they will be referred to as increased fidelity enzymes. hfCas9s were...pyrimidine-to-pyrimidine) Base transversions - edit to different classification of nucleotide base (purine-to-pyrimidine...opposite strands Prime editing and base editing both offer high efficiency and low indel formation compared...genetic changes, including moving entire genes to different locations, by combining other gene editing mechanisms...DNA-targeting of CRISPR-Cas systems. You may also see them referred to as INTEGRATE ( I nsertion of T ransposable ...
  9. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... CRISPR References & Information Genomic Deletions in Mammalian ...elements in mammalian cell lines. Protocol For referenced Tables and Figures, please access the manuscript...(100 μM; see step 1.4 ), 1.0 μl 10x T4 Ligation Buffer, 6.5 μl ddH 2 O, and 0.5 μl T4 Polynucleotide Kinase...μM; see step 3.1.4 ), 5.0 μl restriction enzyme buffer (10x), 4.0 μl (20 U) BbsI restriction enzyme (5,000...successfully adapted to numerous cell types using preferred culture conditions and transfection strategies... before attempting genome editing. Immediately transfer solution from cuvette into 1 ml of culture media...Minimize the time between electroporation and transferring the solution into media to enhance cell viability...
  10. Open Enzyme Collection

    Type
    Collection
    ...pOpen-EcoRIM M.EcoRI DNA methyltransferase 165517 pOpen-Eco31IA Eco31IA DNA methyltransferase 165518 pOpen-NotIM...pOpen-NotIM M.NotI DNA methyltransferase 165527 pOpen-Eco31IB Eco31IB DNA methyltransferase 165536 pOpen-PstIM...pOpen-PstIM M.PstI DNA methyltransferase 165538 pOpen-SfiIM M.SfiI 165538 DNA methyltransferase 165547 pOpen-SapIM1...pOpen-SapIM1 M1.SapI DNA methyltransferase 165557 pOpen-SapIM2 M2.SapI DNA methyltransferase 165558 pOpen-EcoRVM...pOpen-EcoRVM M.EcoRV DNA methyltransferase 165577 pOpen-XbaIM M.XbaI DNA methyltransferase 165578 pOpen-NcoIM ...pOpen-NcoIM M.NcoI DNA methyltransferase 165520 pOpen-T4 PNK T4 PNK polynucleotide kinase 165521 pOpen-lambda red...red operon 165530 pOpen-T4-BGT T4-BGT beta-glucosyltransferase 165531 pOpen-UDG UDG Uracil DNA glycosylase...
  11. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...listing of transfer status for viral preps.... Viral Vector Packaging Service Penn Vector Core Transfer Viral ...Viral Vector Packaging Service: Penn Vector Core Transfer The University of Pennsylvania Vector Core (Link...inventory , which includes all viral vectors transferred from the Penn Vector Core. Chemogenetics (including...mRuby2-GSG-P2A-GCaMP6s-WPRE-pA Biosensor Tobias Bonhoeffer, Mark Huebener, Tobias Rose AV-1-50943 50943-...mRuby2-GSG-P2A-GCaMP6f-WPRE-pA Biosensor Tobias Bonhoeffer, Mark Huebener, Tobias Rose AV-1-68717 68717-...pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA Biosensor Tobias Bonhoeffer, Mark Huebener, Tobias Rose AV-1-68719 68719-...
  12. Viral Vectors

    Type
    Collection
    ...γ-retroviruses, commonly referred to as retroviruses, are the most popular virus for gene transfer in clinical trials... is typically preferred for in-vivo studies because of its low immunogenicity. Different types of viruses...I Use? Use this guide to learn more about the different types of viruses that are commonly used in research... cancer therapy because of their ability to preferentially infect and kill cancer cells. Adenoviruses ...(through standard cloning methods). There are different types of viruses that are commonly used for research...research, each of which exhibit different properties, and thus, are suited for specific research goals... host. Use this guide to learn more about the different types of viruses that are commonly used in research...
  13. Bacterial Expression Systems

    Type
    Collection
    ...metabolite levels. Different plasmids and, often times, different bacterial strains have different levels of precision...pTac GFP, Luciferase (LuxCDABE) Attila Karsi Broad host range vectors for expressing luciferase and fluorescent...produce a therapeutic compound, there are many different ways to alter bacterial genomes. From recombineering...cleavage site. Includes sites for LIC cloning, and a "stuffer" fragment that includes the SacB gene, allowing...protein expression. Vectors come with and without different combinations of His and Strep tags as well as ...control of gene expression so be sure to try a few different systems with your gene/protein of interest. Plasmid...Quorum sensing molecule) Cynthia Collins Contains luciferase inducible by the quorum sensing molecule, 3OC6HSL...
  14. Zhang Lab CRISPR Page

    Type
    Collection
    ...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...plasmid expressing SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase...Library CRISPR page for more information. Full references are below. Return to top Cas9 SAM transcriptional...The MS2-P65-HSF1 activation helper protein Full references are below. Pooled genome-wide human SAM library...Swiech et al., Nature Biotechnology 2014). Full references are below. Available plasmids are described below...The vector can be digested using BsaI ( This is different from BbsI, which is used in the SpCas9 plasmid...with Cas9 in a wide range of applications. Full references are below. The Cas9 knockin mouse can be purchased...
  15. Cre-lox system

    Type
    Collection
    ...PhyBdeltaCreC and PIF6CreN, in AAV donor/transfer vector Cbh AAV Eisenhoffer 131786 pLenti-CreLite CreLite system...Constructs Cre Reporters & Tools Additional Resources References Background The Cre-lox system, derived from P1...respectively) and placed under the control of different promoters. Expression of both N and CCre in the...fusion, or expression system of choice. We also offer ready-to-use viral preparations of select Cre expression...backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV Zhang 60229 AAV...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer 68448...terminus Cre fused to PIF6 CMV Mammalian, Zebrafish Eisenhoffer 131781 pCS2+PhyBΔCreC CreLite - Red light-inducible...
  16. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...tools to perform different types of genome targeting. They are very good source of references. For genome ...double nickase system is that you can express two different chimeric gRNAs with the Cas9 nickase which will... like the wildtype Cas9 does. There are a few references for the double nickase system, including one ...start of my target sequence? The human U6 promoter prefers a 'G' at the transcription start site to have high...system probably have better specificity. A good reference is this Cell paper: http://www.cell.com/abstract...most guides would work, but they sometimes have different efficiency). And it is best if the cut site is...for one well in 24-well plate. A good example/reference is this Cell paper: http://www.cell.com/abstract...
  17. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...TARDBP CMV ALS Shawn Ferguson 133754 pLVX-Puro-TDP-43-A90V TARDBP CMV ALS Shawn Ferguson 133755 pLVX-Puro-...TARDBP CMV ALS Shawn Ferguson 133756 pLVX-Puro-TDP-43-A382T TARDBP CMV ALS Shawn Ferguson 133757 pLVX-Puro-TDP...TARDBP CMV ALS Shawn Ferguson 133758 pLVX-Puro-TDP-43-K263E TARDBP CMV ALS Shawn Ferguson 133759 pLVX-Puro-TDP...TARDBP CMV ALS Shawn Ferguson 133760 pLVX-Puro-TDP-43-P112H TARDBP CMV ALS Shawn Ferguson 133761 pLVX-Puro-TDP...TARDBP CMV ALS Shawn Ferguson 133762 px459-TDP-43 sgRNA1 TARDBP U6 ALS Shawn Ferguson 133763 px459-TDP 43...Suzanne Pfeffer 186013 pCMV Flag-LRRK2 K17A/K18A/R1441G LRRK2 Flag CMV Parkinson's Suzanne Pfeffer 186016...Suzanne Pfeffer 186017 pQE-80L 2xHis-LRRK2 Armadillo 1-552 LRRK2 His T7 Parkinson's Suzanne Pfeffer 186018...
  18. Mammalian RNAi Tools

    Type
    Collection
    ...Plasmids for mammalian RNA interference (RNAi) experiments at Addgene; browse by constitutive lentiviral...Tools for RNAi Browse Plasmids Resources RNA interference (RNAi) is an RNA-mediated gene silencing mechanism...as shRNA (short hairpin RNA) or siRNA (short interfering RNA). Delivery can occur via transfection or ...using viral vectors. Lentiviral vectors are a preferred method for long-term gene silencing. Once the ...below. Figure 1: Overview of shRNA-mediated RNA interference. Created with BioRender.com. shRNA Plasmids ...pSico with pSicoligomaker (Andrea Ventura lab) References Carthew, R. W., & Sontheimer, E. J. (2009). Origins...J. (2009). siRNA vs. shRNA: Similarities and differences . Advanced Drug Delivery Reviews, 61 (9), 746...
  19. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...for a different analyte, a sensor for gene-specific activity, or for popular biosensors in different expression...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics...fluorescent protein (cpFP) or Förster resonance energy transfer (FRET) efficiency of a pair of fluorescent proteins...the articles linked below include variants with different binding affinities or negative-control constructs...environmental factors and the sensor behavior may differ from the original characterization (e.g. in vitro...the plasmids associated with the article. We also offer ready-to-use AAV preparations of select plasmids...Cre-dependent) Cell-specific restoration of stimulus preference after monocular deprivation in the visual cortex...
  20. Antibody Production

    Type
    Collection
    ...formulation buffer is phosphate-buffered saline containing 1 mM sodium azide. This buffer is not compatible...columns. Formulation Buffer After affinity chromatography, antibodies undergo a buffer exchange using centrifugal... cells and will interfere with conjugation. For applications such as these, the buffer can be removed ...webpage. Antibody preparations developed at IPI may differ from Addgene antibodies in “Production & Usage”...extracted from cells, separated by SDS-PAGE, transferred to a membrane, and labeled with the antibody ...
Showing: 1 - 20 of 121 results