Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 494 results for: control

Showing: 201 - 220 of 494 results

  1. Plasmids 101: Yeast Vectors

    Type
    Blog Post
    ...maintained within the yeast cell. These elements control not only the number of plasmids found in each cell... The copy number of these vectors can also be controlled if specific regulatable elements are included...

  3. Validated gRNA Sequences

    Type
    Collection
    ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

  4. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...overcome by using a Tet-inducible virus to allow for controlled expression of reprogramming factors. Check out...the presence of transgenes is still an important control. Additionally, Sendai virus doesn’t rely on promoters...that multiple transfection makes it difficult to control the dose of plasmid the cells receive over the ...Ohtaka, and Mahito Nakanishi. "Novel Strategy to Control Transgene Expression Mediated by a Sendai Virus-Based...

  5. Fluorescent Protein Guide

    Type
    Collection
    ...Optogenetics Plasmids Use light to activate, inhibit, and control molecular signals, cells, or groups of cells. Chemogenetics...

  6. Plasmids for Endogenous Gene Tagging in Human Cells

    Type
    Blog Post
    ...individual proteins under endogenous regulatory control. But even with the advent of CRISPR/Cas9 technology... in human cell lines. Furthermore, the quality control necessary to ensure the edited cells are behaving...

  7. Giving gRNAs a Facelift - Synthetic and Beyond

    Type
    Blog Post
    ...technologies utilize chemical modifications to the RNA to control the entire editing system with a simple LED light...al. Photoswitchable gRNAs for Spatiotemporally Controlled CRSIPR-Cas-based Genomic Regulation. ACS 6, 5...

  8. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    ...virus and its infectivity in check. Engineering controls, safety systems that are built into how something...functions, were designed for this purpose. One such control is dividing up the essential components of a virus...

  9. Viral Vectors 101: An Introduction to AAV

    Type
    Blog Post
    ...and serotype selection. Promoters and serotype control, respectively, cell-specific gene expression and...viral infection. Cre or Flp dependent switches control gene expression via switches placed in your cell...

  10. Mouse Modeling, Part 1: Genetically Engineered Mice

    Type
    Blog Post
    ... in more detail in part 2 of this blog series) controls the cell types in which the conditional recombination...engineered mouse model allows gene expression to be controlled through a drug or small molecule that regulates...

  11. The Twelve Days of CRISPR

    Type
    Blog Post
    ...Addgene gave to me: ways to use optogenetics to control CRISPR editing.  On the fifth day of CRISPR, Addgene...

  12. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ...site or circuit can occur. Promoters The promoter controls how the gene of interest will be expressed; it...et al., 2002). They are useful when you need to control the timing of expression in your experiment. Some... much virus to put into your system, which is controlled through titer (concentration, given as viral ...

  13. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...detection. You’ll also want to use the appropriate controls for your experiment to account for potential non-specific...quantitatively if you also load the gel with appropriate controls for normalizing the protein concentration. To ...plasmid encoding GFP. Actin, a common internal control for Western blots, shows that a similar concentration...

  15. dTAG - You're it!

    Type
    Blog Post
    ...lines Treat parental cells (or cells expressing a control -- for example, an FKBP12F36V-tagged LACZ) with...: dTAG-7 and dTAG-13 Erb et al. Transcription control by the ENL YEATS domain in acute leukemia. Nature...

  18. Open Resources and Plasmid Tools For Studying C. elegans

    Type
    Blog Post
    ...expression in C.elegans. In this system a promoter controls the expression of a GAL-4 driver that can bind...split intein for refined spatiotemporal transgene control in Caenorhabditis elegans." Proceedings of the ...

  19. Adeno Associated Virus (AAV) for Cell and Gene Therapy

    Type
    Blog Post
    ...infect target tissues. Improved specificity through control of gene expression and the selection of specific...CRISPR-AAV vectors Learn about Addgene AAV Quality Control Process Resources on Addgene.org Find ready-to-use...
Showing: 201 - 220 of 494 results