We narrowed to 328 results for: hal.1
-
TypeBlog Post...overcomes many of those limitations (Figure 1). Figure 1: Opto-katanin induces fast, localized microtubule...GTPase Signaling Toolbox. ACS Synthetic Biology, 11(1), 515–521. https://doi.org/10.1021/acssynbio.1c00604... Ononiwu, F., Pal, D., Manikas, J., Taveras, C., Hall, N. A., Silva, J. D., Freshour, J., & Hehnly, H....
-
Fluorescent Proteins 101: History of Fluorescent Proteins
TypeBlog Post...in the crystal jellyfish Aequorea victoria (Figure 1) in molecular detail. On the underside of the “umbrella...after that, in 1994, Prasher’s collaborator Martin Chalfie expressed GFP in exogenous organisms (E. coli, ...and later C. elegans) for the first time. After Chalfie’s work, scientists really started to take notice...Nobel Prize in chemistry was awarded to Shimomura, Chalfie, and Tsien for their work on GFP. This great honor... -
FlipGFP, a novel fluorescence protease reporter to study apoptosis
TypeBlog Post...central ɑ-helix that can be split into 3 parts: (1) β-strands 1-9 (β1-9) and the one ɑ-helix, (2) β-strand ...fluorescence imaging of living organisms can be challenging due to issues with tissue autofluorescence, cell... -
OCaMP: A New Calcium Indicator for Neural Imaging
TypeBlog Post...available in your microscope setup. Figure 1: Excitation (dotted) and emission (solid) spectra ...spanning nearly the entire visible spectrum (Figure 1). The GCaMP series (e.g., jGCaMP8) remains the gold...developed a new calcium indicator, OCaMP. The challenge: Expanding the fluorescent toolbox Modern neuroscience... -
Viral Vectors 101: Biosensors
TypeBlog Post...References Bhalla N., Jolly P., et al. Introduction to Biosensors. Essays Biochem. 2016 Jun 30;60(1):1-8. DOI... -
Hot Plasmids - May 2022
TypeBlog Post... Zebrafish) (Xiong, et al., 2021). Fig. 1: Schematic showing the workflow for the BLITZ system...Biol. 2022. https://doi.org/10.1038/s41556-021-00836-1 Visual barcodes for live cell clonal multiplexing...Leeson Multiplexed images in live cells remains a challenge due to multiple factors, including limitations... -
Back to Bacteria: CRISPR gRNA Multiplexing Using tRNAs
TypeBlog Post...modified slightly with either a 1-7 base poly(U)tail in tRNA-gRNA constructs or a 1-4 base tail from the second...encoded only once, and each <200 bp tRNA-gRNA takes up half the space of a standard pol III-gRNA, which will... -
CRISPR 101: Non-Homologous End Joining
TypeBlog Post...Last updated Sept 1, 2020. This post was contributed by David Wyatt and Dale Ramsden, UNC at Chapel Hill...the course of repair by NHEJ are typically small (1-10 bp) but extremely heterogeneous. There is consequently...Strande NT, Pryor JM, Strom CN, Mieczkowski P, Burkhalter MD, Oh S, Qaqish BF, Moore DT, Hendrickson EA... -
Sequencing Primers
TypeGuide... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC... forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of Drosophila mini-white gene, reverse... -
CRISPR 101: Epigenetics and Editing the Epigenome
TypeBlog Post...P2A-PuroR for lentiviral expression. Figure 1: dCas9-p300 adds H3K27ac marks to histones in promoter...lentiviral transduction. Lysine-specific Demethylase 1 (LSD1) Tatjana Sauka-Spengler's lab has deposited ... demethylase to demethylate enhancer regions (Mendenhall et al., 2013). By comparing gene activation when...sorting and selection of transduced cells. Grant Challen’s lab also created constitutive (pCMV-dCas9-D3A)...contributed to updating this article. References Haldeman JM, Conway AE, Arlotto ME, et al (2018) Creation...Fowler T, Rees R, Kramer A, Martens A, Edwards JR, Challen GA (2016) Reprogrammable CRISPR/Cas9-based system...Find plasmids from this publication at Addgene. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung... -
Technologies Enabled by NanoLuc® Luciferase
TypeBlog Post...cellular analysis products at Promega. References 1. Hall, M.P., et al. (2012) Engineered luciferase reporter...furimazine by Promega’s Chemistry group is a good story (1). From a deep sea shrimp to a compact powerhouse of...information. Many of our technology platforms like HaloTag® Fusion Protein, codon-optimized Firefly luciferase...concentrations of biological molecules. FRET sensors face challenges of photobleaching, autofluorescence, and, in ...cyan-excitable donors, phototoxicity. Another challenge to using FRET sensors comes when employing optogenetic...Researchers have sought to alleviate many of these challenges by exchanging the fluorescent donor for a bioluminescent... -
Molecular Biology Reference
TypeGuide...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Delta(lac- proAB) [F ...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...for adding the next nucleotide, the reaction is halted once the fluorescently tagged base is incorporated...converted back to a regular base and thus do not halt the reaction. Illumina NGS, therefore does not require... -
Antibodies 101: Reading a Flow Plot
TypeBlog Post...Figure 1). Clustered events are called a population. Figure 1: While...from flow cytometry experiments can be a little challenging to understand if you’ve never done any flow. ...., Sait, K., Anfinan, N., Al-Wasiyah, mohammad khalid, Huwait, E., Gari, M., & Al-Qahtani, M. (2018).... -
Plasmids 101: E. coli Strains for Protein Expression
TypeBlog Post...folding, and deal with sub-optimal codon usage (Table 1) A few mutations are common to all or most expression...curated list of Bacterial Expression Systems Table 1: E. coli expression strains Note: All strains are...suited for recombinant protein expression. Many challenges can arise when over-expressing a foreign protein...functional RNaseE which results in longer transcript half-life F- ompT lon hsdSB (rB- mB-) gal dcm rne131... -
Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs
TypeBlog Post...aware of the April 1 deadline for companies to submit an application on their behalf. If an individual...and non-profit organizations do not have the April 1 H-1B queue process or quota like industry, these organizations... National Interest Waiver. The three prongs are: (1) The foreign national’s proposed work endeavor must...-1B, you need to prove 3 threshold requirements: (1) that you have international recognition for your ... -
Adapting Toehold Switches to Detect Zika Virus
TypeBlog Post...detects samples at clinically relevant concentrations (1-3 fM; 1x106-fold lower than before), and our combined... health, energy, and sustainability. References 1. Pardee, Keith, et al. "Rapid, Low-Cost Detection ...symptoms, including the development of fetal microcephaly and Guillain-Barré syndrome. In response, the... -
Lentiviral CRISPR Libraries Enable Genome-Scale, Knockout Screening
TypeBlog Post...plasmids. The Zhang lab, on the other hand, uses a 1 plasmid, single infection system. Genome wide mouse...possible before,” said the Broad Institute's Ophir Shalem. “Whole regions of the genome which were not accessible...depends on your experiment and method of selection. Shalem and Sanjana say they kept a high representation... CRISPR-Cas9 Knockout Screening in Human Cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson... -
Finding Your Science Policy Path
TypeBlog Post...relations, advocacy, and writing legislation (see Figure 1 for career map). The beautiful part of science policy...about science policy as a profession. Figure 1: Science policy can lead you to many paths! For a ...That’s what makes it so wonderful. The most challenging part of jumping into this career path from academia... your hair out, your successes, failures, and challenges you’ve overcome. This information may help you...completely new field without issue. This may be more challenging if you are trying to apply for an outright job... -
Plan Your Experiment
TypeGuide...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...generally higher than HDR pegRNA optimization can be challenging Prime Edit Repress or Interfere (CRISPRi) Reduce... -
SciComm with the Experts at Science in the News Part 2
TypeBlog Post...to the interview with Science in the News Chapter 1: Introduction - Vini and Amy tell us a little about...This is the second half of a two-part interview with Vini Mani and Amy Gilson from Science in the News...involved in science communication. In this second half of our conversation with Vini Mani and Amy Gilson...