We narrowed to 9 results for: hal.1
-
TypeGuide...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...
-
Adenovirus Guide
TypeGuide...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or... This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli ... viruses. The adenoviral backbone plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For...production system. Figure is based on the use of pAdEasy-1. Created with BioRender.com. AdMax™ AdMax™ is another...landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392-021-00487-6 (...as a Zika virus vaccine . Scientific Reports, 10 (1), 3613. https://doi.org/10.1038/s41598-020-60238-5... -
Optogenetics Guide
TypeGuide...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...plasmids . Halorhodopsins Halorhodopsins are light-gated inward chloride pumps isolated from halobacteria. Wild-type...Jaws Browse Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense... -
CRISPR Guide
TypeGuide... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa... -
Adeno-associated virus (AAV) Guide
TypeGuide...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...short coding sequences of channelrhodopsins, halorhodopsins, and other optogenetic genes makes them suitable...) and a gRNA together into an rAAV capsid is challenging due to its limited packaging capacity, especially... -
Sequencing Primers
TypeGuide... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC... forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of Drosophila mini-white gene, reverse... -
Molecular Biology Reference
TypeGuide...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Delta(lac- proAB) [F ...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...for adding the next nucleotide, the reaction is halted once the fluorescently tagged base is incorporated...converted back to a regular base and thus do not halt the reaction. Illumina NGS, therefore does not require... -
Plan Your Experiment
TypeGuide...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...generally higher than HDR pegRNA optimization can be challenging Prime Edit Repress or Interfere (CRISPRi) Reduce... -
Chemogenetics Guide
TypeGuide...out our Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic ligand. The chemogenetic...Ikefuama EC, Slaviero AN, Silvagnoli AD, Crespo EL, Schalau R, Gott M, Tree MO, Dunbar GL, Rossignol J, Hochgeschwender...