Skip to main content
Addgene

We narrowed to 328 results for: hal.1

Showing: 1 - 20 of 328 results
  1. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ...with CRISPR has been challenging, with protocols using dsDNA templates achieving ~1-10% efficiency. Easi-CRISPR...B. Gurumurthy, and Masato Ohtsuka. Nat Protoc. 13(1) (2018):195-215. PubMed PMID: 29266098 Creating knock-in...that this basic concept of gRNA design is still challenging for researchers using CRISPR, and that standardizing...paraphrased in the tweet below. The complexity and challenges of homology directed repair (HDR) are echoed ...s a list of blog posts to help you tackle the challenges of DNA repair (with bonus gRNA design resources...
  2. Designing Your Chalk Talk for the Academic Job Interview

    Type
    Blog Post
    ...acceptable. Aims should be mechanistic, doable by 1-3 people in 1-5 years, and contribute to resolving the overarching...possible, do at least two full length practices (~1 h) and get feedback. It’s also helpful to practice...I include in my chalk talk?" So what exactly is a chalk talk? On the surface, a chalk talk is quite simple...present a "chalk talk." However, few, if any, faculty job candidates have seen an actual chalk talk. Their...first exposure to a chalk talk is usually their own. This is a problem. The chalk talk is effectively ... hone a chalk talk. Yet, I often hear, "I have an interview next week and it includes a chalk talk. What...steps to chalk talk preparation: Define your research vision. Organize your vision into a chalk talk format...
  3. Countdown to Halloween @Addgene

    Type
    Blog Post
    ...glorious trophy. Sure it’s plastic and you have to share 1 trophy among 6 people, but you’ve earned bragging ...Halloween is only 2 days away and here at Addgene we couldn’t be more excited! As a small, tight-knit...things: fun, teamwork, and competition. And our Halloween celebration this Friday will combine all of these...these. Addgenies have been organizing Halloween festivities for years – searching our photo archives I...destroyed to protect the innocent revelers. Our Halloween costume contests have become an annual tradition...colleagues. Success is sweet – as sweet as all that Halloween candy you’ll gorge yourself on in the coming days...Hopefully, I’ve made clear how excited we get for Halloween and how seriously we take costume design. In case...
  4. Streaking for Single Colonies: The Streak Plate Challenge

    Type
    Blog Post
    ...technique. Time for the #BioSci3319 #StreakPlateChallenge part 1. Lab B needs a redo :-( @SandTBioSci ... the lab used three different species for the challenge, but one species always outcompeted the other ...it would be a perfect fit for the streak plate challenge. Chromoproteins are a subset of the fluorescent... distinguish colonies from one another in the challenge. To create a successful streak plate, first the...colonies in the last quadrant after incubation. The challenge is usually successful for the students. “They ...colonies. I should probably make it a bit more challenging, potentially by using a thicker bacterial suspension...transformation efficiency.  Aside from the Streak Plate Challenge, Westenberg’s course includes Winogradsky columns...
  5. Six Spooky Science Stories and Halloween at Addgene

    Type
    Blog Post
    ...Molecular and cellular endocrinology 215.1-2 (2004): 1-10. PubMed PMID: 15026169. Soo, Rochelle M., et al...another snail, completing its lifecycle. Halloween genes The Halloween genes are a set of cytochrome P450 genes...incorporate science themes into our fun activities and Halloween is no exception. For the past 10+ years, Addgenies...ping pong table. This year, in addition to the Halloween contest, we’ve also carved pumpkins (yes, Blugene...melanogaster (Gilbert, 2004). Mutations in these genes are lethal, associated with defective exoskeleton formations...1983.3 (1983): 813-816. Gilbert, Lawrence I. "Halloween genes encode P450 enzymes that mediate steroid...company culture at Addgene See some of our previous Halloween costume contests ...
  6. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ... had to navigate the challenges involved in plant synthetic biology. Challenge #1: Public perception of...facilitates plant science. Challenge #3: Intellectual property There is another challenge associated with molecular... of well-characterized genetic tools make it challenging to engineer a specific function in these multicellular...fibers. And because working with plants can be challenging, there are a lot of unexplored areas in plant...manner. At Revolution Bio, we are addressing this challenge directly by developing a plant biotechnology product...inspire and open a new conversation about GMOs.  Challenge #2: Technical obstacles to plant synthetic biology... a product without the use of these parts is challenging, and it’s made even more difficult by the fact...
  7. Overcoming the Challenges of Lentiviral Production

    Type
    Blog Post
    ...is best for larger genes such as Cas9. See figure 1 for an example of how changing transfection ratios...tools, producing lentivirus, can pose certain challenges. Whether choosing a system that is the best fit...will provide an overview of some of the common challenges associated with producing and using lentivirus...make these optimization experiments a bit more challenging. With these considerations in mind, when planning...
  8. The Challenges of Cell Culture

    Type
    Blog Post
    ...testing. You can find Nick on LinkedIn. References 1. Skloot, Rebecca, and Bahni Turpin. The immortal life...
  9. Biosensor AAV Preps

    Type
    Collection
    ...none Constitutive 1 Looger 137955 pAAV.CAG.iAChSnFR CAG iAChSnFR none Constitutive 1, 9 Looger 121922 ...Constitutive 1, 9, rg* GENIE 162379 pGP-AAV-syn-FLEX-jGCaMP8f-WPRE Syn jGCaMP8f none Cre dependent 1, 5, 9, ...dependent 1, 5, 9, rg* GENIE 169258 AAV-hSyn-Soma-jGCaMP8f Syn soma-jGCaMP8f none Constitutive 1, 9, rg*...Constitutive 1, 5, rg* Looger 176753 AAV-mDlx-jGCaMP8f-WPRE Dlx jGCaMP8f none Constitutive 1, 9, rg* Looger...Constitutive 1, 9, rg* Looger 176759 pZac2.1-GfaABC1D-lck-jGCaMP8f GfaABC1D jGCaMP8f none Constitutive 1, 9 Looger...Constitutive 1, 5, 9, rg* GENIE 162377 pGP-AAV-syn-FLEX-jGCaMP8s-WPRE Syn jGCaMP8s none Cre dependent 1, 9, rg...dependent 1, 9, rg* GENIE 167572 AAV-hSyn-Ribo-jGCaMP8s Syn ribo-jGCaMP8s none Constitutive 1 Fyhn 169256...
  10. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...elegans. Proc Natl Acad Sci U S A. 2019 Aug 1. Alexander Gottschalk Voltage Near-infrared fluorescent voltage...of cellular physiology. Nat Commun. 2020 Aug 4;11(1):3881. Adam Cohen Calcium GCaMP6f expression in forebrain...Dynamics in High-Ca Organelles. Cell Chem Biol. 2016 Jun 1. pii: S2451-9456(16)30163-5. Teresa Alonso , Javier... intracellular calcium. Nat Commun. 2021 Dec 9;12(1):7159. Dorus Gadella Calcium Teal genetically encoded...Neurophotonics. 2024 Apr;11(2):024207. doi: 10.1117/1.NPh.11.2.024207. Robert Campbell Calcium Ratiometric...orange-emitting fluorescent proteins. Nat Commun. 2017 Sep 5;8(1):431. Wolf Frommer Calcium Red-, yellow-, or cyan-...
  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [... pLKO.1 mTagBFP2 rat DJ-1 shRNA PARK7 U6 Parkinson's Timothy Ryan 223563 pmCherry-Synaptojanin-1-145 SYNJ1... pHTN-HaloTag_C9orf72:1-481 C9orf72 Halo CMV ALS Cheryl Arrowsmith 210987 pHTC-HaloTag_C9orf72:1-481 C9orf72...Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X.1 PINK1 KD PINK1 GST... His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's... His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...
  12. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...oligos 1:10 in ddH 2 O ( e.g., 1.0 μl annealed oligos + 9.0 μl ddH 2 O to yield a concentration of 1 μM)....35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10 min. Optimize PCR ...sgRNAs manually or using freely available online tools 1 . Use these tools to help identify guide sequences...PAM) at the genomic recognition site. NOTE: Figure 1 describes possible deletion strategies for genes and... deletion of Pim1 in mouse ( Mus musculus ; Table 1 , Figure 2A ). NOTE: In this example, sgRNA-A’s protospacer...complement sequences of the Pim1 sgRNA from Table 1 are found in Table 2 . Obtain 24- or 25-mer oligos...SpCas9, but does not contain markers for selection 1 . Other constructs may be utilized, such as pX458 ...
  13. Optogenetics AAV Preps

    Type
    Collection
    ...Constitutive 1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell...Constitutive 1, 2, 5, 9 Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden...dependent 1, 5, 9, rg* Deisseroth 26971 pAAV-CaMKIIa-eNpHR 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 ...Constitutive 1, 5, rg* Yizhar 125713 AAV-hSyn1-SIO-eOPN3-mScarlet-WPRE Syn eOPN3 mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198511 pAAV_hSyn-DIO-PdCO-mScarlet-WPRE Syn PdCO mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198516 pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE EF1a PdCO mScarlet Cre dependent 1, 5 Yizhar...
  14. p53 Pathway

    Type
    Collection
    ...-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific angiogenesis inhibitor 1 Bax BCL2-associated...inhibitor type 1), member 1 PERP TP53 apoptosis effector PIDD p53-induced death domain protein 1 PIGs Etoposide... Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine kinase...kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2...receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell surface death receptor ...SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2...Noxa Phorbol-12-myristate-13-acetate-induced protein 1; also known as PMAIP1 p14ARF Cyclin-dependent kinase...
  15. Validated gRNA Sequences

    Type
    Collection
    ... Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927...csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes...
  16. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha...
  17. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin... HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin...Nucleolus (granular component) 133963 UBTF-HaloTag AICSDP-80 HaloTag Nucleolar transcription factor UBF Nucleolus...
  18. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...aeruginosa PA14 234855 (Set 1) 1000000254 Inhibition P. aeruginosa X. Liu NA 1 5,981 (Set 1) 5,971 (Set 2) CHyMErA... Human Doench 3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313...Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut - Version 3 90294 (1 plasmid...Libraries 153101-153106 Knockout Yeast Borodina N/A 1 Varies Bovine CRISPR Knockout Libraries 213927, 213928...pgRNAs 1,718 Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and...Root 3rd 4 76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and...and Root 3rd 4 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and...
  19. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TATGGTGTCAAACCACAGtgcatgatgactgtctTTCCAGTCTGACCGATGA Dlk1 (site #1) TAL3240 & TAL3241 TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA...TACAAGACAGGGGACAGAagctaaactcatggactgCACAGCTAAGGTAAGA hemogen (site #1) TAL3274 & TAL3275 TGGAAGACCCGTTGGAGAaagagatcccaccaacTGAAATAAAAGATTCAGA...TCTTCCGTTTCCACATCCaccacatcccaacagagcAGCGGGAGCAGCAGTAAA hif1al (site #1) TAL3278 & TAL3279 TGTTTCAGCAGAGCCCCGctgaagagctccccatGGAGATGGAAGGAGTGGA...TGATCCTCTGGCCCATTAacgactcctgggccaaCTCAAGTAGGGGAAACGA Park2 (site #1) TAL 3012 & TAL 3013 TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA...TTTCCTCTCATAGTCAATattaattctctatttgGCTCAAAATGTCAGTAAA Plekho1b-1 TAL3142 & TAL3143 TCGTCAAAGCGGGGCCCTcaggatgccaatcaacAGCCTGTGCAGCCCGACA...TATAGCATGATGATGGAAacggaccttcattcccCGGGACCCCAAACCAACA sox2 (site #1) TAL3178 & TAL3179 TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA...TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA tetmethylcytosinedioxygenase 1 TAL3572 & TAL3573 TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA...
  20. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous Type II bacterial...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548...WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang...Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. 2015. CETCh-seq: CRISPR epitope...
Showing: 1 - 20 of 328 results