Skip to main content

We narrowed to 1,061 results for: tra

Showing: 201 - 220 of 1061 results
  1. Chemogenetics Guide

    Type
    Guide
    ... neuronal signaling by increasing intracellular cAMP concentrations. There is currently one Gs-DREADD,...populations in Japan, making it an attractive option for translational studies, however, it has off-target...against hM4Di, and is especially attractive for use in translational studies because it is FDA- and EMA-approved...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...important for dosing in animal studies, made them attractive targets for development into chemogenetic tools...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...
  2. Guide to Using Pooled Libraries

    Type
    Guide
    ...Functional Screens New Tool for Lineage Tracing: The ClonTracer Library NGS Quality Control for Pooled ...that can be used for applications like lineage tracing, drug screening, and gene function studies. In ...proteins (such as cell surface receptors or transcription factors), or observing the effects of mutagenesis...cells, making barcode libraries ideal for lineage tracing. Barcode libraries can be used for clonal fitness...tumors. Advantages Extremely high resolution clonal tracking Low biological perturbation Limitations No functional...libraries direct an inactive Cas enzyme fused to a transcriptional activator to target genes or regulatory regions...regions, where it stimulates transcription by recruiting activators or modifying local chromatin. Inhibition...
  3. Modular Cloning Guide

    Type
    Guide
    ...constructs constrained only by the ability of E. coli to maintain the final plasmid after transformation. Figure... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...several cassettes and generate multi-construct transgenic plants. GreenGate 2.0 Toolkit Plant Expression...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne...
  4. Antibody Guide

    Type
    Guide
    ...samples to extract proteins. Homogenize (tissues only), lyse, and then collect protein extract by centrifugation...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....to lot, as immune responses have high inter- and intra-individual variability. Other Affinity Reagents ...and therefore should be kept at 4 °C. Record and track lot numbers for all antibodies used in the lab. ...reaction in the presence of several different substrates. The luminescence produced by the reaction can... an SDS-PAGE gel to separate proteins by size. Transfer proteins from the gel to a membrane. Incubate ...and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray film...
  5. Molecular Cloning Techniques

    Type
    Guide
    ...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ...custom overhangs, which is not possible with traditional restriction enzyme cloning. Scientists have utilized... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ...
  6. Sequencing Primers

    Type
    Guide
    ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...Forward Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene Forward V5 Reverse ACCGAGGAGAGGGTTAGGGAT...
  7. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ... focused ultrasound (FUS), intracorporeal (IC), intracerebroventricular (ICV), intramuscular (IM), intrathecal...Cre-dependent transgenes can also be paired with Cre-expressing transgenic mouse lines to restrict transgene expression...engineered to have enhanced function after intravenous administration, distributing widely throughout the organism...with broad CNS or PNS transduction, cell type specificity, or retrograde transport in neurons. (b) Genetic...capsids or transgenes. Sensory neurons and liver appear especially susceptible to off-target transgene expression-induced...differently in different mouse strains, a phenomenon that we are calling “strain-specific tropism.” For example...in many other strains, including FVB/NCrl, 129S1/SvImJ, DBA/2J, and C57BL/6J, the strain in which the ...
  8. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ...controlled by titrating the transposase to transposon ratios. High ratios of transposase to transposon result...]. Like other transposons, piggyBac™ has two components, a transposon and a transposase. The piggyBac™...stable transgenic cell lines. The traditional method of making stable cell lines is to transfect, select... piggyBac™ transposon. These plasmids, when combined with a source of piggyBac™ transposase (available...distributor) allow you to quickly transfer a DNA sequence from the transposon vector to one of many TTAA sequences...folks at Transposagen. This post was contributed by Amar Singh and Mathew Goodwin from Transposagen What ...What is the piggyBac™ transposon? The piggyBac™ transposon was originally identified in moths in 1983, but...
  9. Addgene's eBook Collection

    Type
    Guide
    ...First Edition, trans. About CRISPR 101 en español January 2024 | First Edition, trans. About Una traducción...and management, resources for identifying your transferable skills, and tips on the job application process...
  10. Common Injection Routes in Mice

    Type
    Blog Post
    ...considered quite invasive. Restraint: anesthesia Location: trachea Gauge (tracheal tubing): 23–20 Volume: ...advanced Intranasal instillation Intranasal instillation is very similar to its intratracheal counterpart...Injection Route Restraint Location Gauge Volume Skill Intravenous Mechanical restrainer or anesthesia ...mL Expert Intratracheal Anesthesia Trachea 20–23 (tubing) < 0.07 mL Advanced Intranasal Anesthesia ...after initial mouse training. Other techniques require more skill and additional training, going from intermediate...biorender.com.   Needle techniques Intravenous Intravenous (IV) injections are most commonly administered...institutional oversight is required. Restraint: mechanical restraint or anesthesia Location: tail vein or...
  11. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...piggyBac (PB) transposon: The PB transposon is a mobile genetic element that transposes via a “cut and...Generates transgene-free and vector-free cells Limited genomic integration Multiple transfections required...Delivery DNA-Free High High Transgene-free and vector-free Multiple transfections required Protein Delivery...vector, but transient expression of Cre recombinase allows for deletion of the inserted transgenes that are.... This system is transfected into cells as a donor plasmid containing the transposon, along with a helper...sequences, which the PB transposase recognizes. Following reprogramming, transgenes can be removed by re-...promoters for transcriptional regulation, so it requires a different approach for regulating transgene expression...
  12. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...Ensure methanol concentration in transfer buffer is < 20% Wet transfer Increase transfer time Increase...large.  Transfer method   Wet transfers are more efficient, so if you’re struggling to transfer a large...consider using a wet transfer with a long transfer time. Be aware that the transfer works by electricity...decrease alcohol in transfer buffer Small proteins: Over-transferring Transfer with two membranes...increase alcohol in transfer buffer Mixed proteins: Transferring issues Transfer with two membranes...which increase as protein concentration increases, show the protein concentrations are within the antibody...commercially available options to choose from.  Transfer Transfers are a little trickier than gels and may require...
  13. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...and stable expression of the transgene   Transfer plasmids The transfer plasmid is the vector you clone...requires continuous administration of Dox to repress transgene expression. In contrast, in the Tet-on system...membrane pores) transfection. These techniques are still used and efficiently transfer plasmid DNA efficiently...comes to transferring DNA into primary cells or non-dividing cells. To target these un-transfectable cells...property makes the lentivirus an attractive choice for a gene transfer vector. Lentiviral vectors Although... purify and concentrate your lentiviral particles to get them to the optimum concentration to infect your...lentiviral transfer vectors The most widely used inducible lentiviral vector system is the tetracycline (Tet...
  14. Sleeping Beauty Awakens for Genome Engineering

    Type
    Blog Post
    ...contains the transposase gene (red) for expressing the transposase enzyme.2.) The transposase enzyme is ...which cuts the DNA.3.) The released transposon can now bind a strand of DNA with a TA dinucleotide (there...removal of the transposon; the plasmid is then degraded by the cell.4.) The transposase creates a double...double strand break in the DNA and allows the tranposon to integrate. Additionally, the TA sequence is duplicated....   The Sleeping Beauty transposon system The Sleeping Beauty (SB) transposon system is one such system...perform gene transfer in vertebrates. The system is comprised of 2 components: 1) an SB transposase, the enzyme...enzyme required for catalysis of transposition; and 2) a transposon containing the gene-expression cassette...
  15. Important Considerations When Using AAVs

    Type
    Blog Post
    ...experiment! Traveling from the Original Location - Axonal Transport It has been demonstrated that certain...cell type? Location (3): Traveling from the original location - Axonal Transport in the CNS What tissue...their efficiency at transducing different brain regions. Although AAV2 can transduce many tissue types,...axoplasmic transport. These AAVs may move toward the cell bodies of neurons (retrograde transport) or towards...retrograde and anterograde transport, but they also have similar transport characteristics (velocities...strong CNS tropism (4). If axonal transport is not desirable, transport can be reduced by injecting a smaller...scAAV) (7). As single stranded DNA viruses, AAVs normally require second strand synthesis before gene ...
  16. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ... non-edited strand, they can cause the cell to remake that strand using the edited strand as the template...the nicked target strand. The initial result is a heteroduplex, with overlapping strands of edited and unedited...less than 10%. In contrast, the original paper introducing prime editing demonstrated ~20-50% efficiency...delivery strategy, cell type, and goal of the experiment can all impose different constraints and affect...Improving reverse transcriptase efficiency Building upon prior reverse transcriptase research, the Liu...the edit into one strand, there’s a mismatch between the original sequence on one strand and the edited ...other strand. To guide heteroduplex resolution to favor the edit, the Liu lab turned to a strategy they...
  17. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...enhancement of transcriptional activation via binding of multiple copies of a transcription factor to a ...endosomal trafficking to signaling pathways to the cell cycle. Good tools for measuring intracellular pH are...of its substrate, luciferin, which releases energy as a photon. The photon energy is transferred to the...ribosome during translation, which knocks off all mRNA binding proteins as it travels along the mRNA to...the stop codon. Thus a non-translated mRNA will appear yellow, but a translated mRNA will be red. This system...plasmids, Halstead et al demonstrated that 91% of reporter mRNAs were untranslated in the nucleus, confirming...P-bodies are translationally repressed whereas the nonsequestered pool goes on to initiate translation. These...
  18. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ...breakage of both DNA strands - a double-strand break (DSB). DSBs can be caused by intracellular factors such ...CRISPR/Cas-mediated Transgenesis (2018). Pubmed. The Road Less Traveled: Strategies to Enhance the Frequency...overhang. This will serve as both a substrate for proteins required for strand invasion and a primer for DNA...DNA repair synthesis. The ssDNA strand then displaces one strand of the homologous DNA donor and can template...pathways: classical double-strand break repair (DSBR), synthesis-dependent strand-annealing (SDSA), and break-induced...dHJs are four-stranded branched structures that form when elongation of the invasive strand “captures” and...on the crossing strand (horizontally at the purple arrows) or on the non-crossing strand (vertically at...
  19. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...created the tetracycline-controlled transactivator (tTA). They fused TetR with the transcriptional activation... polymerase and transcription factors. Since the promoter region drives transcription of a target gene...repressor then prevents transcription from occurring, which means that transcription is now OFF.   We’ll...its native context, the tetracycline repressor (TetR) can bind to the tetracycline operator sequences (TetO...(TetO), preventing transcription. In the presence of tetracycline (Tet), TetR preferentially binds Tet...Response Element (TRE)), allowing transcription to proceed. When tetracycline or one of its derivatives is ...other. For example, the GAL4 transcription factor cannot drive transcription from the QUAS promoter, and...
  20. Plasmids 101: Terminators and PolyA signals

    Type
    Blog Post
    ...initiation step of gene transcription; today we'll provide an overview on how transcription stops, or termination...from the transcription machinery. Terminators are found downstream of the gene to be transcribed, and typically...generally serves to promote transcript longevity in eukaryotes and promote transcript degradation in prokaryotes...GC-rich hairpin in the RNA transcript followed by a weakly bound poly-uracil tract as shown in the figure ...thought to destabilize the transcription complex, initiating cleavage of the transcript.   Figure 1: ...Hepatitis Virus Posttranscriptional Regulatory Element Enhances Expression of Transgenes  Delivered by ...terminators in the context of AAV transgene expression levels. Transcription Termination Rho-dependent termination...
Showing: 201 - 220 of 1061 results