Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 1,064 results for: tra

Showing: 201 - 220 of 1064 results

  1. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ... Protocols AAV Titration by qPCR Using SYBR Green Technology AAV Titration by qPCR...AAV Titration protocol. Protocols... Posts Mol Bio Protocols Introduction The AAV Titration protocol can be used to determine the number of...Size in bp of Addgene plasmid #59462 : 6208 bp Concentration of Addgene plasmid #59462 : 1.07 μg/μL Molecular...again but store at 4 °C and use within 1 week. Keep track of the Ct value for each standard over time. They...over from the production process (DNase does not penetrate the virion). 5 μL sample + 39 μL H 2 O + 5 μL ...sample (do not vortex) Incubate 30 min at 37 °C Transfer to ice ** Critical: do NOT treat your plasmid ...

  2. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Iodixanol Gradient Ultracentrifugation AAV Titration by ddPCR AAV Titration by qPCR Using SYBR Green Technology...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...recombination deficient bacterial strains, such as NEB Stable cells. These strains reduce the frequency of homologous...three production plasmids (transfer, packaging, and helper plasmid) are transfected into cells which then ...different serotype(s) for transduction of a given organ. Tissue Serotype Central nervous system AAV1, AAV2...

  3. Lentiviral Vector Guide

    Type
    Guide
    ...deletion is transferred to the 5’ LTR after one round of reverse transcription, inhibiting transcription of the...centrifuged to concentrate. You can use crude or concentrated viral particles to transduce the cells of ...cannot be used in direct transfections for transient expression of a transgene. For more detailed protocols...cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency...packaging plasmids. tat in trans Trans-activator; binds TAR to activate transcription from the LTR promoter...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...

  4. CRISPR Guide

    Type
    Guide
    ...may be a single-stranded oligonucleotide, double-stranded linear DNA, or a double-stranded DNA (dsDNA) plasmid...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems... HNH, cleave opposite strands of the target DNA. This results in a double-strand break (DSB) within the...discovered. Browse Plasmids: Single-Strand Break (Nick) , Double-Strand Break (Cut) Increasing Cas9 PAM flexibility...incorporated into the DNA by reverse transcription. The edited DNA strand displaces the unedited 5’ flap, ...Tn7-like transposases found in diverse species of microbes. However, synthetic dCas9-transposase fusions...recruits the transposase proteins to the target location in the genome, where the transposase then carries...

  5. Adenovirus Guide

    Type
    Guide
    ...to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the transgene of interest and both ... the transduced cells, transgene expression delivered through rAdV vectors is normally transient and short-lived...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses... and late adenoviral transcript regions between the two ITRs with the transgenes of interest. The size...Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest, the ITRs, and homology...possibility that recombination between the transfected adenoviral transfer plasmid and the E1 region integrated...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...

  6. Promoters

    Type
    Guide
    ...sense or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...to the mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding...noncoding strand, as this is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding...template for the translation of a protein. RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA... eukaryotic promoters, including transcription and the transcription complex. Educational...to DNA. RNA polymerase transcribes DNA to mRNA, which is ultimately translated into a functional protein...

  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... centrifuged to concentrate. Crude or concentrated virus can then be used to transduce the cells of interest...cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...recombination-deficient bacteria strains, such as NEB Stable cells. These strains reduce the frequency of homologous...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line...

  8. Molecular Biology Reference

    Type
    Guide
    ... culminated in the central dogma of molecular biology, that proteins are translated from RNA, which is...is transcribed from DNA. The Genetic Code The genetic code is a set of rules for translating the information..., double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form...proteins can be translated, the DNA is converted to RNA in a process called transcription. RNA uses the ...proteins are transcribed and processed into mature messenger RNA (mRNA), which is then translated into proteins...reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA that typically...Promoter Region Drives transcription of the insert. The promoter recruits transcriptional machinery and can...

  9. Plan Your Experiment

    Type
    Guide
    ... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa...fused to transcriptional activators that need to be within a given range of the transcription start site... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...efficiently transfect. However, note that this method is most useful for cell lines that you can transfect at ...into cells. These methods are more transient than plasmid transfection or viral vectors, reducing the risk...your target cells are not transcribing DNA to mRNA, nor do they need to translate mRNA to protein. Instead...is helpful in cells that are difficult to transfect, transduce, or may not express common promoters. Browse...

  10. Optogenetics Guide

    Type
    Guide
    ...synthetic two-part transcription factors - Cry2 and CIB1 are fused to a transcriptional activation domain...inactivated transgene expression in neurons. Front Neural Circuits. 6:47. PMID 22866029 Wietek J, Beltramo R, ...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...has higher conductance at physiological pH and trafficks well to the membrane. Excitatory (Depolarizing..., C1V1(t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t), Chrimson, ChrimsonR...eNpHR, eNpHR2.0, eNpHR3.0 Red-shifted peak action spectra Example: Jaws Browse Halorhodopsin plasmids . Archaerhodopsins...Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins: cation channels from Chlamydomonas...

  11. Chemogenetics Guide

    Type
    Guide
    ... neuronal signaling by increasing intracellular cAMP concentrations. There is currently one Gs-DREADD,...populations in Japan, making it an attractive option for translational studies, however, it has off-target...against hM4Di, and is especially attractive for use in translational studies because it is FDA and EMA...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...important for dosing in animal studies, made them attractive targets for development into chemogenetic tools...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...

  12. Modular Cloning Guide

    Type
    Guide
    ...constructs constrained only by the ability of E. coli to maintain the final plasmid after transformation. Figure... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...several cassettes and generate multi-construct transgenic plants. GreenGate 2.0 Toolkit Plant Expression...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne...

  13. Antibody Guide

    Type
    Guide
    ...samples to extract proteins. Homogenize (tissues only), lyse, and then collect protein extract by centrifugation...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....to lot, as immune responses have high inter- and intra-individual variability. Other Affinity Reagents ...and therefore should be kept at 4 °C. Record and track lot numbers for all antibodies used in the lab. ...reaction in the presence of several different substrates. The luminescence produced by the reaction can... an SDS-PAGE gel to separate proteins by size. Transfer proteins from the gel to a membrane. Incubate ...and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray film...

  14. Molecular Cloning Techniques

    Type
    Guide
    ...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ...custom overhangs, which is not possible with traditional restriction enzyme cloning. Scientists have utilized... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ...

  15. Sequencing Primers

    Type
    Guide
    ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...Forward Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene Forward V5 Reverse ACCGAGGAGAGGGTTAGGGAT...

  16. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ... focused ultrasound (FUS), intracorporeal (IC), intracerebroventricular (ICV), intramuscular (IM), intrathecal...Cre-dependent transgenes can also be paired with Cre-expressing transgenic mouse lines to restrict transgene expression...engineered to have enhanced function after intravenous administration, distributing widely throughout the organism...with broad CNS or PNS transduction, cell type specificity, or retrograde transport in neurons. (b) Genetic...capsids or transgenes. Sensory neurons and liver appear especially susceptible to off-target transgene expression-induced...differently in different mouse strains, a phenomenon that we are calling “strain-specific tropism.” For example...in many other strains, including FVB/NCrl, 129S1/SvImJ, DBA/2J, and C57BL/6J, the strain in which the ...

  17. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ...controlled by titrating the transposase to transposon ratios. High ratios of transposase to transposon result...]. Like other transposons, piggyBac™ has two components, a transposon and a transposase. The piggyBac™...stable transgenic cell lines. The traditional method of making stable cell lines is to transfect, select... piggyBac™ transposon. These plasmids, when combined with a source of piggyBac™ transposase (available...distributor) allow you to quickly transfer a DNA sequence from the transposon vector to one of many TTAA sequences...folks at Transposagen. This post was contributed by Amar Singh and Mathew Goodwin from Transposagen What ...What is the piggyBac™ transposon? The piggyBac™ transposon was originally identified in moths in 1983, but...

  18. Common Injection Routes in Mice

    Type
    Blog Post
    ...considered quite invasive. Restraint: anesthesia Location: trachea Gauge (tracheal tubing): 23–20 Volume: ...advanced Intranasal instillation Intranasal instillation is very similar to its intratracheal counterpart...Injection Route Restraint Location Gauge Volume Skill Intravenous Mechanical restrainer or anesthesia ...mL Expert Intratracheal Anesthesia Trachea 20–23 (tubing) < 0.07 mL Advanced Intranasal Anesthesia ...after initial mouse training. Other techniques require more skill and additional training, going from intermediate...biorender.com.   Needle techniques Intravenous Intravenous (IV) injections are most commonly administered...institutional oversight is required. Restraint: mechanical restraint or anesthesia Location: tail vein or...

  19. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...piggyBac (PB) transposon: The PB transposon is a mobile genetic element that transposes via a “cut and...Generates transgene-free and vector-free cells Limited genomic integration Multiple transfections required...Delivery DNA-Free High High Transgene-free and vector-free Multiple transfections required Protein Delivery...vector, but transient expression of Cre recombinase allows for deletion of the inserted transgenes that are.... This system is transfected into cells as a donor plasmid containing the transposon, along with a helper...sequences, which the PB transposase recognizes. Following reprogramming, transgenes can be removed by re-...promoters for transcriptional regulation, so it requires a different approach for regulating transgene expression...

  20. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...Ensure methanol concentration in transfer buffer is < 20% Wet transfer Increase transfer time Increase...large.  Transfer method   Wet transfers are more efficient, so if you’re struggling to transfer a large...consider using a wet transfer with a long transfer time. Be aware that the transfer works by electricity...decrease alcohol in transfer buffer Small proteins: Over-transferring Transfer with two membranes...increase alcohol in transfer buffer Mixed proteins: Transferring issues Transfer with two membranes...which increase as protein concentration increases, show the protein concentrations are within the antibody...commercially available options to choose from.  Transfer Transfers are a little trickier than gels and may require...
Showing: 201 - 220 of 1064 results