Skip to main content

We narrowed to 17 results for: tra

Showing: 1 - 17 of 17 results
  1. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Iodixanol Gradient Ultracentrifugation AAV Titration by ddPCR AAV Titration by qPCR Using SYBR Green Technology...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...recombination deficient bacterial strains, such as NEB Stable cells. These strains reduce the frequency of homologous...three production plasmids (transfer, packaging, and helper plasmid) are transfected into cells which then ...different serotype(s) for transduction of a given organ. Tissue Serotype Central nervous system AAV1, AAV2...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...deletion is transferred to the 5’ LTR after one round of reverse transcription, inhibiting transcription of the...centrifuged to concentrate. You can use crude or concentrated viral particles to transduce the cells of ...cannot be used in direct transfections for transient expression of a transgene. For more detailed protocols...cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency...packaging plasmids. tat in trans Trans-activator; binds TAR to activate transcription from the LTR promoter...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...
  3. CRISPR Guide

    Type
    Guide
    ...may be a single-stranded oligonucleotide, double-stranded linear DNA, or a double-stranded DNA (dsDNA) plasmid...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems... HNH, cleave opposite strands of the target DNA. This results in a double-strand break (DSB) within the...discovered. Browse Plasmids: Single-Strand Break (Nick) , Double-Strand Break (Cut) Increasing Cas9 PAM flexibility...incorporated into the DNA by reverse transcription. The edited DNA strand displaces the unedited 5’ flap, ...Tn7-like transposases found in diverse species of microbes. However, synthetic dCas9-transposase fusions...recruits the transposase proteins to the target location in the genome, where the transposase then carries...
  4. Adenovirus Guide

    Type
    Guide
    ...to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the transgene of interest and both ... the transduced cells, transgene expression delivered through rAdV vectors is normally transient and short-lived...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses... and late adenoviral transcript regions between the two ITRs with the transgenes of interest. The size...Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest, the ITRs, and homology...possibility that recombination between the transfected adenoviral transfer plasmid and the E1 region integrated...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...
  5. Promoters

    Type
    Guide
    ...sense or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...to the mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding...noncoding strand, as this is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding...template for the translation of a protein. RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA... eukaryotic promoters, including transcription and the transcription complex. Educational...to DNA. RNA polymerase transcribes DNA to mRNA, which is ultimately translated into a functional protein...
  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... centrifuged to concentrate. Crude or concentrated virus can then be used to transduce the cells of interest...cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...recombination-deficient bacteria strains, such as NEB Stable cells. These strains reduce the frequency of homologous...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line...
  7. Molecular Biology Reference

    Type
    Guide
    ... culminated in the central dogma of molecular biology, that proteins are translated from RNA, which is...is transcribed from DNA. The Genetic Code The genetic code is a set of rules for translating the information..., double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form...proteins can be translated, the DNA is converted to RNA in a process called transcription. RNA uses the ...proteins are transcribed and processed into mature messenger RNA (mRNA), which is then translated into proteins...reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA that typically...Promoter Region Drives transcription of the insert. The promoter recruits transcriptional machinery and can...
  8. Plan Your Experiment

    Type
    Guide
    ... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa...fused to transcriptional activators that need to be within a given range of the transcription start site... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...efficiently transfect. However, note that this method is most useful for cell lines that you can transfect at ...into cells. These methods are more transient than plasmid transfection or viral vectors, reducing the risk...your target cells are not transcribing DNA to mRNA, nor do they need to translate mRNA to protein. Instead...is helpful in cells that are difficult to transfect, transduce, or may not express common promoters. Browse...
  9. Optogenetics Guide

    Type
    Guide
    ...generate two-part transcription factors, where Cry2 and CIB1 are fused to a transcriptional activation domain...domain, allowing light to activate transcription. Another popular strategy takes advantage of the LOV domains...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...has higher conductance at physiological pH and traffics well to the membrane. The optogenetic toolbox ...to as an optoGPCR or OptoXR). Combining the extracellular domain of an endogenous light-sensitive receptor...receptor, like mammalian rhodopsin, with the intracellular domain of an endogenous GPCR, such as adrenergic...element such as an opsin. When the luciferase substrate is added, the luciferase enzyme generates light...
  10. Chemogenetics Guide

    Type
    Guide
    ... neuronal signaling by increasing intracellular cAMP concentrations. There is currently one Gs-DREADD,...populations in Japan, making it an attractive option for translational studies, however, it has off-target...against hM4Di, and is especially attractive for use in translational studies because it is FDA- and EMA-approved...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...important for dosing in animal studies, made them attractive targets for development into chemogenetic tools...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...
  11. Guide to Using Pooled Libraries

    Type
    Guide
    ...Functional Screens New Tool for Lineage Tracing: The ClonTracer Library NGS Quality Control for Pooled ...that can be used for applications like lineage tracing, drug screening, and gene function studies. In ...proteins (such as cell surface receptors or transcription factors), or observing the effects of mutagenesis...cells, making barcode libraries ideal for lineage tracing. Barcode libraries can be used for clonal fitness...tumors. Advantages Extremely high resolution clonal tracking Low biological perturbation Limitations No functional...libraries direct an inactive Cas enzyme fused to a transcriptional activator to target genes or regulatory regions...regions, where it stimulates transcription by recruiting activators or modifying local chromatin. Inhibition...
  12. Modular Cloning Guide

    Type
    Guide
    ...constructs constrained only by the ability of E. coli to maintain the final plasmid after transformation. Figure... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...several cassettes and generate multi-construct transgenic plants. GreenGate 2.0 Toolkit Plant Expression...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne...
  13. Antibody Guide

    Type
    Guide
    ...samples to extract proteins. Homogenize (tissues only), lyse, and then collect protein extract by centrifugation...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....to lot, as immune responses have high inter- and intra-individual variability. Other Affinity Reagents ...and therefore should be kept at 4 °C. Record and track lot numbers for all antibodies used in the lab. ...reaction in the presence of several different substrates. The luminescence produced by the reaction can... an SDS-PAGE gel to separate proteins by size. Transfer proteins from the gel to a membrane. Incubate ...and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray film...
  14. Molecular Cloning Techniques

    Type
    Guide
    ...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ...custom overhangs, which is not possible with traditional restriction enzyme cloning. Scientists have utilized... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ...
  15. Sequencing Primers

    Type
    Guide
    ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...Forward Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene Forward V5 Reverse ACCGAGGAGAGGGTTAGGGAT...
  16. Addgene's eBook Collection

    Type
    Guide
    ...First Edition, trans. About CRISPR 101 en español January 2024 | First Edition, trans. About Una traducción...and management, resources for identifying your transferable skills, and tips on the job application process...
  17. Educational Resources

    Type
    Guide
    ... Antibiotic Concentrations for Bacterial Selection What is a Plasmid? Genetic Code Strain Information ...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...
Showing: 1 - 17 of 17 results