Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 241 results for: p

Showing: 221 - 240 of 241 results

  6. Deep Dive: qPCR

    Type
    Blog Post
    ...potential. BioTechniques 26:112–115.Marino JH; Cook P; and Miller KS. 2003. Accurate and statistically verified...

  7. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...suitable for high throughput applications. Trepte P, et al. J. Mol. Biol. 2015. PubMed PMID: 26264872 ...Text. Seeliger MA, Young M, Henderso MN, Pellicena P, King DS, Falick AM, and Kuriyan J. Protein Sci. 2005...

  8. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...Furthermore, they find that during stress, mRNAs in P-bodies are translationally repressed whereas the nonsequestered... has developed rapid-response luciferase (firefly P. pyralis) reporter plasmids for use in high-throughput...

  9. CRISPR Guide

    Type
    Guide
    ... Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & Hsu, P. D. (2022). Systematic... 29556040 Chen, P. J., Hussmann, J. A., Yan, J., Knipping, F., Ravisankar, P., Chen, P., Chen, C., Nelson...target DNA PCR P olymerase C hain R eaction; Used to amplify a specific sequence of DNA pegRNA P rime E dit...Kleinstiver, B. P., Prew, M. S., Tsai, S. Q., Topkar, V. V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li,...Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman,...Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J. M., Terns, R. M., Terns, M. P., White, M. F., Yakunin.... V., Randolph, P. B., Davis, J. R., Sousa, A. A., Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C....

  10. Chemogenetics Guide

    Type
    Guide
    .... H. J., DiBerto, J. F., Giguere, P. M., Sassano, F. M., Huang, X. P., Zhu, H., Urban, D. J., White, K.../10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H. G., Falk, M. S., Chan, S. D., Meng, F.,...15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav, P. N., Daigle, T. L., Urban, D. J., Lee, H. M., Sciaky...Sciaky, N., Simmons, A., Nonneman, R. J., Huang, X. P., Hufeisen, S. J., Guettier, J. M., Moy, S. S., Wess...Bonaventura, J., Lesniak, W., Mathews, W. B., Sysa-Shah, P., Rodriguez, L. A., Ellis, R. J., Richie, C. T., Harvey...j.isci.2025.112022. PMID: 40092615 Magnus, C. J., Lee, P. H., Atasoy, D., Su, H. H., Looger, L. L., & Sternson..., Y., Oyama, K., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata...

  11. Modular Cloning Guide

    Type
    Guide
    ...for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX MoClo YTK Yeast...MoClo-YTK toolkit for protein expression and secretion in P. pastoris (a.k.a. K. phaffii ). GoldenPiCS Kit Yeast...Sauer 62 plasmids for advanced strain engineering in P. pastoris (a.k.a. K. phaffii ), including overexpression... CRISPR/Cas9 mediated genome editing in the yeast P. pastoris (a.k.a. K. phaffii ). NT-CRISPR Plasmid ...

  12. Plan Your Experiment

    Type
    Guide
    ...27984732 Doman, J. L., Sousa, A. A., Randolph, P. B., Chen, P. J., & Liu, D. R. (2022). Designing and executing...CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that enables...Dixit, A., Parnas, O., Li, B., Chen, J., Fulco, C. P., Jerby-Arnon, L., Marjanovic, N. D., Dionne, D., ...Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Maeder, M. L., Joung, ...

  13. Lentiviral Vector Guide

    Type
    Guide
    ...Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M....Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...12649500 Timms, R. T., Tchasovnikarova, I. A., & Lehner, P. J. (2018). Differential viral accessibility (DIVA...

  14. Adenovirus Guide

    Type
    Guide
    ...new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021). Viral vector platforms within...Custers, J., Vellinga, J., Hendriks, J., Jahrling, P., Roederer, M., Goudsmit, J., Koup, R., & Sullivan...new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral vector vaccine...in a new window) Rosewell, A., Vetrini, F., & Ng, P. (2011). Helper-dependent adenoviral vectors . Journal...

  15. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (...T., Inaba, T., Mizukami, H., Ozawa, K., & Colosi, P. (2004). The adenovirus E1A and E1B19K genes provide...Link opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary ...

  16. Optogenetics Guide

    Type
    Guide
    ...22866029 Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Wiegert JS. 2015. An improved chloride-conducting...PMID 26965121 Yizhar O, Fenno L, Zhang F, Hegemann P, Diesseroth K. 2011. Microbial opsins: a family of...Beyrière F, Tsunoda SP, Mattis J, Yizhar O, Hegemann P, Deisseroth K. 2008. Red-shifted optogenetic excitation...

  17. Science Guides

    Type
    Guide
    ...Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which form an...

  18. Sequencing Primers

    Type
    Guide
    ...vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG...

  19. Immunology Research Plasmids and Resources

    Type
    Collection
    ... 2 J2, TCRGJ2 TRGJP T cell receptor gamma joining P JP, TCRGJP TRGJP1 T cell receptor gamma joining P1... External Resouces Immport : Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen J, Hu Z, Zalocusky...

  20. Molecular Biology Reference

    Type
    Guide
    ...Met M AUG Phenylalanine Phe F UUU, UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG...
Showing: 221 - 240 of 241 results