We narrowed to 11 results for: p

... Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & Hsu, P. D. (2022). Systematic... 29556040 Chen, P. J., Hussmann, J. A., Yan, J., Knipping, F., Ravisankar, P., Chen, P., Chen, C., Nelson...target DNA PCR P olymerase C hain R eaction; Used to amplify a specific sequence of DNA pegRNA P rime E dit...Kleinstiver, B. P., Prew, M. S., Tsai, S. Q., Topkar, V. V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li,...Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman,...Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J. M., Terns, R. M., Terns, M. P., White, M. F., Yakunin.... V., Randolph, P. B., Davis, J. R., Sousa, A. A., Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C....

.... H. J., DiBerto, J. F., Giguere, P. M., Sassano, F. M., Huang, X. P., Zhu, H., Urban, D. J., White, K.../10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H. G., Falk, M. S., Chan, S. D., Meng, F.,...15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav, P. N., Daigle, T. L., Urban, D. J., Lee, H. M., Sciaky...Sciaky, N., Simmons, A., Nonneman, R. J., Huang, X. P., Hufeisen, S. J., Guettier, J. M., Moy, S. S., Wess...Bonaventura, J., Lesniak, W., Mathews, W. B., Sysa-Shah, P., Rodriguez, L. A., Ellis, R. J., Richie, C. T., Harvey...j.isci.2025.112022. PMID: 40092615 Magnus, C. J., Lee, P. H., Atasoy, D., Su, H. H., Looger, L. L., & Sternson..., Y., Oyama, K., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata...

... M., Beyrière, F., Tsunoda, S. P., Mattis, J., Yizhar, O., Hegemann, P., & Deisseroth, K. (2008). Red-...Emiliani, V., Entcheva, E., Hedrich, R., Hegemann, P., Konrad, K. R., Lüscher, C., Mahn, M., Pan, Z. H....Wietek, J., Beltramo, R., Scanziani, M., Hegemann, P., Oertner, T. G., & Wiegert, J. S. (2015). An improved...R., Ramakrishnan, C., Huguenard, J. R., Hegemann, P., & Deisseroth, K. (2011). Neocortical excitation/...21796121 Yizhar, O., Fenno, L., Zhang, F., Hegemann, P., & Diesseroth, K. (2011). Microbial opsins: a family...

...for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX MoClo YTK Yeast...MoClo-YTK toolkit for protein expression and secretion in P. pastoris (a.k.a. K. phaffii ). GoldenPiCS Kit Yeast...Sauer 62 plasmids for advanced strain engineering in P. pastoris (a.k.a. K. phaffii ), including overexpression... CRISPR/Cas9 mediated genome editing in the yeast P. pastoris (a.k.a. K. phaffii ). NT-CRISPR Plasmid ...

...27984732 Doman, J. L., Sousa, A. A., Randolph, P. B., Chen, P. J., & Liu, D. R. (2022). Designing and executing...CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that enables...Dixit, A., Parnas, O., Li, B., Chen, J., Fulco, C. P., Jerby-Arnon, L., Marjanovic, N. D., Dionne, D., ...Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Maeder, M. L., Joung, ...

...Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M....Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...12649500 Timms, R. T., Tchasovnikarova, I. A., & Lehner, P. J. (2018). Differential viral accessibility (DIVA...

...new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021). Viral vector platforms within...Custers, J., Vellinga, J., Hendriks, J., Jahrling, P., Roederer, M., Goudsmit, J., Koup, R., & Sullivan...new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral vector vaccine...in a new window) Rosewell, A., Vetrini, F., & Ng, P. (2011). Helper-dependent adenoviral vectors . Journal...

...Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (...T., Inaba, T., Mizukami, H., Ozawa, K., & Colosi, P. (2004). The adenovirus E1A and E1B19K genes provide...Link opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary ...

...Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which form an...

...vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG...

...Met M AUG Phenylalanine Phe F UUU, UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG...