Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 265 results for: ttl

Showing: 221 - 240 of 265 results

  4. Plasmids 101: Restriction Cloning

    Type
    Blog Post
    ...enzymes that can digest large amounts of DNA in as little as 10 minutes, but check with your enzyme’s manufacturer...

  6. Antibodies 101: Validation

    Type
    Blog Post
    ...strong antibody signal in the retinal sample, but little to no signal in the liver sample, which you do ...

  12. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...PRESTO-TANGO kit directly for drug screening or easily shuttle the optimized, expression validated GPCR sequences...

  14. Adenovirus Guide

    Type
    Guide
    ...Used to alter infectivity and tropism. pShuttle Class of shuttle/transfer vectors for recombinant adenoviral...rAdV vectors, you generally need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing...and homology regions for recombination with the shuttle plasmid. For a summary of all adenoviral plasmid...plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the..., the transgene of interest is cloned into the shuttle plasmid, verified, and linearized with the restriction...adenoviral genes necessary for virus production. The shuttle plasmid and the adenoviral backbone plasmid have...standard BJ5183 with supercoiled pAdEasy and the shuttle plasmid, but this method results in a higher background...

  15. Pouring LB Agar Plates

    Type
    Protocol
    ...appropriately sized bottle for autoclaving. We make 400 mL of agar in 1 L bottles and 200 mL of agar in...to the same bottle and swirl to form a medium/agar colloid. Cover the opening of the bottle with its cap...Use lab tape to label the bottle with your initials, the date, and the bottle contents. This will clear... in 500 mL bottles. The extra empty volume is necessary to prevent your molten agar from boiling over ...but do not make an air-tight seal!) and tape the bottle with autoclave tape. The autoclave tape will darken...clear up any confusion later if your forget your bottle in the autoclave. Place the gel mix in the autoclave...pouring your plates - be sure to leave room for your bottle of molten gel mix, a tube rack containing the appropriate...

  16. AAV Production in HEK293 Cells

    Type
    Protocol
    ...a sterile 250 mL bottle. Aliquot 774 mL of DMEM + 2% HI-FBS into a sterile 1 L bottle. Add each plasmid...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated... mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized water + 100 mL of 1 M Tris HCl...Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting multiple times Adjust pH to...complete media, then transfer the cells into a sterile bottle. Rinse the CS2 with 100 mL of DMEM complete medium...plasmid DNA into the bottle containing the Opti-MEM. Mix well. Add 4 mL of PEI (1:2 μg DNA to μg PEI ratio...ratio). Shake the bottle up/down vigorously for 30 sec (it’s okay to make bubbles). Incubate at RT for 15...

  17. Water Bath Protocol

    Type
    Protocol
    ...water bath weights can hold bottles in place. After putting your tubes or bottles in the water bath, place...baths that exist as scientists work with tubes and bottles of different sizes in the lab. Some water baths...water baths hold many liters of water to incubate bottles and containers. Water baths can also be placed ...be used in water baths with instructions on the bottle, for example, number of drops per liter. Place ...floating, you do not need to necessarily maneuver the bottles or tubes to identify them. Once the water bath ...temperature, remove the lid and place your tubes or bottles into the water bath. Many items may float in the...

  18. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...Loosely close the cap on the bottle (do NOT close all the way or the bottle may explode!) and then loosely...LB, weigh out the following into a 500 mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH...loosely cover the entire top of the bottle with aluminum foil. Autoclave and allow to cool to room temperature...temperature. Now screw on the top of the bottle and store the LB at room temperature. When ready to grow ...

  19. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...usually use one or the other, but there is very little difference between the two. Note: Make sure to ...increases the density of your DNA sample causing it settle to the bottom of the gel well, instead of diffusing...later use, use long-wavelength UV and expose for as little time as possible to minimize damage to the DNA....

  20. Sequencing Primers

    Type
    Guide
    ...CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward primer pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector...
Showing: 221 - 240 of 265 results