Skip to main content

We narrowed to 266 results for: ttl

Showing: 221 - 240 of 266 results
  1. Plasmids 101: Restriction Cloning

    Type
    Blog Post
    ...enzymes that can digest large amounts of DNA in as little as 10 minutes, but check with your enzyme’s manufacturer...
  2. Antibodies 101: Validation

    Type
    Blog Post
    ...strong antibody signal in the retinal sample, but little to no signal in the liver sample, which you do ...
  3. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...PRESTO-TANGO kit directly for drug screening or easily shuttle the optimized, expression validated GPCR sequences...
  4. Adenovirus Guide

    Type
    Guide
    ...Used to alter infectivity and tropism. pShuttle Class of shuttle/transfer vectors for recombinant adenoviral...rAdV vectors, you generally need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing...and homology regions for recombination with the shuttle plasmid. For a summary of all adenoviral plasmid...plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the..., the transgene of interest is cloned into the shuttle plasmid, verified, and linearized with the restriction...adenoviral genes necessary for virus production. The shuttle plasmid and the adenoviral backbone plasmid have...standard BJ5183 with supercoiled pAdEasy and the shuttle plasmid, but this method results in a higher background...
  5. Pouring LB Agar Plates

    Type
    Protocol
    ...appropriately sized bottle for autoclaving. We make 400 mL of agar in 1 L bottles and 200 mL of agar in...to the same bottle and swirl to form a medium/agar colloid. Cover the opening of the bottle with its cap...Use lab tape to label the bottle with your initials, the date, and the bottle contents. This will clear... in 500 mL bottles. The extra empty volume is necessary to prevent your molten agar from boiling over ...but do not make an air-tight seal!) and tape the bottle with autoclave tape. The autoclave tape will darken...clear up any confusion later if your forget your bottle in the autoclave. Place the gel mix in the autoclave...pouring your plates - be sure to leave room for your bottle of molten gel mix, a tube rack containing the appropriate...
  6. AAV Production in HEK293 Cells

    Type
    Protocol
    ...a sterile 250 mL bottle. Aliquot 774 mL of DMEM + 2% HI-FBS into a sterile 1 L bottle. Add each plasmid...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated... mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized water + 100 mL of 1 M Tris HCl...Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting multiple times Adjust pH to...complete media, then transfer the cells into a sterile bottle. Rinse the CS2 with 100 mL of DMEM complete medium...plasmid DNA into the bottle containing the Opti-MEM. Mix well. Add 4 mL of PEI (1:2 μg DNA to μg PEI ratio...ratio). Shake the bottle up/down vigorously for 30 sec (it’s okay to make bubbles). Incubate at RT for 15...
  7. Water Bath Protocol

    Type
    Protocol
    ...water bath weights can hold bottles in place. After putting your tubes or bottles in the water bath, place...baths that exist as scientists work with tubes and bottles of different sizes in the lab. Some water baths...water baths hold many liters of water to incubate bottles and containers. Water baths can also be placed ...be used in water baths with instructions on the bottle, for example, number of drops per liter. Place ...floating, you do not need to necessarily maneuver the bottles or tubes to identify them. Once the water bath ...temperature, remove the lid and place your tubes or bottles into the water bath. Many items may float in the...
  8. Sequencing Primers

    Type
    Guide
    ...CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector Forward pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector...
  9. Molecular Cloning Techniques

    Type
    Guide
    ... entry clone. The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now...vectors deposited with Addgene), it can be rapidly shuttled into any compatible Gateway destination vector...
Showing: 221 - 240 of 266 results