We narrowed to 16 results for: ttl
-
TypeCollection...genomic DNA stuffer Vogelstein 18703 pEZYshuttle Shuttle Modified pShuttle-CMV plasmid with Gateway cassette...recombining shuttle plasmids Vogelstein 16401 pAdEasy-2 Adenoviral For recombining shuttle plasmids; for...insertion of GFP expression cassette. Bunz 16402 pShuttle Shuttle For production of viruses containing transgene...under a chosen promoter Vogelstein 16403 pShuttle-CMV Shuttle For production of viruses containing transgene...containing transgene under CMV Bamburg 50958 ShuttleNSE Shuttle For production of viruses containing transgene...Neuron-specific enolase (NSE) promoter Bamburg 50959 ShuttleMCP Shuttle For production of viruses containing transgene...cofilin promoter (MCP) Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus Shuttle For production of viruses with multicistronic...
-
Brzezinski Lab CRISPR Collection
TypeCollection...nuclear reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide...same plasmid by utilizing one of the dual guide shuttle plasmids to insert a second guide within a U6-guide... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...73355 Adeno X shuttle vector with EF1 promoter and SV40 polyA pICPIS-CB 73356 AdenoX shuttle vector with...can be cloned into these transfer vectors using shuttle vectors pICPIS-EF1 and pICPIS-CB. pICPIS-EF1 contains... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic Tools .../Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table by keyword or sort by ... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...integrate into host genome pAdTrack-CMV - Shuttle vector for transgene expression ...1 - Recombine plasmids from the shuttle vectors into pAdEasy for viral production... -
Validated gRNA Sequences
TypeCollection...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus... -
Neurodegeneration Plasmid Collection
TypeCollection...160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1-Worm ABeta-...Fawzi 127616 myc-KIF5A KIF5A Myc CMV ALS Josef Kittler 128510 pPHAGE-CR-PINK1-C-TAP PINK1 Flag, HA CMV...-eGFP-C1-VPS35 VPS35 GFP CMV Parkinson's Josef Kittler 163858 VPS35 shRNA1 VPS35 Parkinson's Lei Lu 163859... -
Synthetic Biology - Overview
TypeCollection...to cloning and genomic modification, including shuttle, integration, reporter, and tagging vectors. Metabolism... -
Plant Plasmids and Resources
TypeCollection...JoinTRV , an improved vector system based on tobacco rattle virus (TRV) that simplifies gene silencing and ... -
CRISPR Plasmids - Plants
TypeCollection...snoRNA U3 BsaI none S. pyogenes Yang 47024 pUC gRNA Shuttle Mt U6.6 inFusion none S. pyogenes Parrott 50591... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Aguiar M, Beausoleil SA, Paulo JA, Rinehart J, Huttlin EL, Gygi SP. Nat Methods 2022 Nov;19(11):1371-1375... -
CRISPR References and Information
TypeCollection...p201B Cas9 ; p201H Cas9 ; p201N Cas9 ; pUC gRNA Shuttle PDF, 500 KB Sabatini and Lander gRNA cloning into... -
Plan Your Experiment
TypeCollection...DNA to serve as template for the repair. Once you settle on your gRNA, you can design a donor DNA to have... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...50929 Plant BsaI none S. pyogenes Yang pUC gRNA Shuttle 47024 Plant inFusion none S. pyogenes Parrott pCBC-DT1T1... -
Antibody Guide
TypeCollection...produce large amounts of a single antibody with little variation. Recombinant plasmids - Antibodies can... -
CRISPR Guide
TypeCollection...Chavez, A., Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman...