We narrowed to 268 results for: ttl
-
TypeBlog Post...mammalian vectors are designed to shuttle between species. Figure 1: Shuttle vectors are vectors that can...! Wait, what even counts as a shuttle vector? Are viral vectors shuttle vectors? The production of viral...host range plasmids shuttle vectors? While it’s technically accurate to say that shuttle vectors have a “...lecture slide. That shared language is the basis of shuttle vectors, which can function in unrelated host species...species. Created with BioRender.com. How are shuttle vectors different from other plasmids? If we all...cells and get on with my experiment? Not quite. Shuttle vectors have to address several big differences...recognized by its host’s replication machinery. A shuttle vector designed for unrelated bacteria should include...
-
The Materials Science of Optogenetics Experiments
TypeBlog Post...the laser power source itself. Pulse generation (TTL pulse) is a standard electronics protocol not specific...experiments we discussed last week are only half of the battle when using optogentics to answer a research question... -
Adenovirus Plasmids
TypeCollection...safety. Adenoviral Vector Guide Shuttle Plasmids Browse commonly used shuttle plasmids for adenoviral vector...our database for shuttle plasmids with inserts. ID Plasmid Description PI 16402 pShuttle For production ...genomic DNA stuffer Vogelstein 18703 pEZYshuttle Modified pShuttle-CMV (Addgene #16403) plasmid with Gateway...Browse shuttle plasmids, adenoviral backbone plasmids, and bacterial strains for adenoviral vector production...Plasmids Adenoviral Plasmids Adenoviral Plasmids Shuttle Plasmids Adenoviral Plasmids Adenoviral Strains...researchers generally need to use two plasmids: A shuttle plasmid (or transfer plasmid) containing the transgene...and homology regions for recombination with the shuttle plasmid. This collection provides a curated selection... -
Brzezinski Lab CRISPR Collection
TypeCollection...nuclear reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide...same plasmid by utilizing one of the dual guide shuttle plasmids to insert a second guide within a U6-guide... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...73355 Adeno X shuttle vector with EF1 promoter and SV40 polyA pICPIS-CB 73356 AdenoX shuttle vector with...can be cloned into these transfer vectors using shuttle vectors pICPIS-EF1 (Addgene #73355) and pICPIS-... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic Tools .../Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table by keyword or sort by ... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...integrate into host genome pAdTrack-CMV - Shuttle vector for transgene expression ...1 - Recombine plasmids from the shuttle vectors into pAdEasy for viral production... -
Validated gRNA Sequences
TypeCollection...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus... -
Synthetic Biology - Overview
TypeCollection...to cloning and genomic modification, including shuttle, integration, reporter, and tagging vectors. Metabolism... -
Viral Vector Guides and Plasmids
TypeCollection...genetic information to be delivered (transfer or shuttle plasmid) and one or more plasmids containing the... -
Plant Plasmids and Resources
TypeCollection...JoinTRV , an improved vector system based on tobacco rattle virus (TRV) that simplifies gene silencing and ... -
CRISPR Plasmids - Plants
TypeCollection...snoRNA U3 BsaI none S. pyogenes Yang 47024 pUC gRNA Shuttle Mt U6.6 inFusion none S. pyogenes Parrott 50591... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Beausoleil, S. A., Paulo, J. A., Rinehart, J., Huttlin, E. L., & Gygi, S. P. (2022). A multi-purpose, ... -
CRISPR References and Information
TypeCollection...p201B Cas9 ; p201H Cas9 ; p201N Cas9 ; pUC gRNA Shuttle PDF, 500 KB Sabatini and Lander gRNA cloning into... -
Neurodegeneration Plasmid Collection
TypeCollection...160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1-Worm ABeta-...Fawzi 127616 myc-KIF5A KIF5A Myc CMV ALS Josef Kittler 128510 pPHAGE-CR-PINK1-C-TAP PINK1 Flag, HA CMV...-eGFP-C1-VPS35 VPS35 GFP CMV Parkinson's Josef Kittler 163858 VPS35 shRNA1 VPS35 Parkinson's Lei Lu 163859... -
Plan Your Experiment
TypeCollection...DNA to serve as template for the repair. Once you settle on your gRNA, you can design a donor DNA to have... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...50929 Plant BsaI none S. pyogenes Yang pUC gRNA Shuttle 47024 Plant inFusion none S. pyogenes Parrott pCBC-DT1T1... -
Antibody Guide
TypeCollection...produce large amounts of a single antibody with little variation. Recombinant plasmids - Antibodies can... -
Plasmids 101: Gateway Cloning
TypeBlog Post...recombination sites (attL-left- and attR-right-, Figure 1). Under certain conditions, the attL and attR sites...into an attL-entry-TOPO vector. TOPO cloning adds short end(s) to facilitate cloning into an attL-containing... and a attL-entry vector. This fragment is inserted in a multiple cloning site (MCS) of an attL-containing... attP1 sites; attB2 only with attP2, attL1 only with attR1; attL2 only with attR2, and so on. Take a look...reactions. Recombination of attP and attB sites creates attL and attR sites. Gateway vectors contain modified... clone containing the DNA of interest flanked by attL sites. As a byproduct of the reaction, the ccdB ... BP and LR reactions. The BP reaction creates an attL-flanked entry clone. The LR reaction creates an ... -
Selecting Your Plasmid Purification Kit
TypeBlog Post...quality required. Some applications require very little DNA and you can get away with slightly lower quality... in a lysis buffer for too long or if you get a little overzealous with your pipetting. Another is the...from the more obvious swaps like using smaller bottles or recycled cardboard packaging, there are some...concentrated buffers reduces plastic waste from bottles and the overall weight of the package during shipping...materials Reduced plastic in spin columns and buffer bottles Waste tubes are made of 100% post-consumer ...post-consumer recycled plastic Reduced plastic in buffer bottles Fewer plastic consumables Fewer pipette tips ...you to run thousands of reactions with relatively little work after the initial setup. (Addgene actually...