...the laser power source itself. Pulse generation (TTL pulse) is a standard electronics protocol not specific...experiments we discussed last week are only half of the battle when using optogentics to answer a research question...

...genomic DNA stuffer Vogelstein 18703 pEZYshuttle Shuttle Modified pShuttle-CMV plasmid with Gateway cassette...recombining shuttle plasmids Vogelstein 16401 pAdEasy-2 Adenoviral For recombining shuttle plasmids; for...insertion of GFP expression cassette. Bunz 16402 pShuttle Shuttle For production of viruses containing transgene...under a chosen promoter Vogelstein 16403 pShuttle-CMV Shuttle For production of viruses containing transgene...containing transgene under CMV Bamburg 50958 ShuttleNSE Shuttle For production of viruses containing transgene...Neuron-specific enolase (NSE) promoter Bamburg 50959 ShuttleMCP Shuttle For production of viruses containing transgene...cofilin promoter (MCP) Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus Shuttle For production of viruses with multicistronic...

...nuclear reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide...same plasmid by utilizing one of the dual guide shuttle plasmids to insert a second guide within a U6-...

...73355 Adeno X shuttle vector with EF1 promoter and SV40 polyA pICPIS-CB 73356 AdenoX shuttle vector with...can be cloned into these transfer vectors using shuttle vectors pICPIS-EF1 and pICPIS-CB. pICPIS-EF1 contains...

... AAV page for more information. pAdTrack-CMV - Shuttle vector for transgene expression ...under a CMV promoter pAdTrack - Shuttle vector for transgene expression ...1 - Recombine plasmids from the shuttle vectors into pAdEasy for viral production...

...Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic Tools .../Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table by keyword or sort by ...

...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus...

...to cloning and genomic modification, including shuttle, integration, reporter, and tagging vectors. Metabolism...

...JoinTRV , an improved vector system based on tobacco rattle virus (TRV) that simplifies gene silencing and ...

... snoRNA U3 BsaI none S. pyogenes Yang pUC gRNA Shuttle Mt U6.6 inFusion none S. pyogenes Parrott pCBC-...

...160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1-Worm ABeta-...Fawzi 127616 myc-KIF5A KIF5A Myc CMV ALS Josef Kittler 128510 pPHAGE-CR-PINK1-C-TAP PINK1 Flag, HA CMV...-eGFP-C1-VPS35 VPS35 GFP CMV Parkinson's Josef Kittler 163858 VPS35 shRNA1 VPS35 Parkinson's Lei Lu 163859...

...Aguiar M, Beausoleil SA, Paulo JA, Rinehart J, Huttlin EL, Gygi SP. Nat Methods 2022 Nov;19(11):1371-1375...

...p201B Cas9 ; p201H Cas9 ; p201N Cas9 ; pUC gRNA Shuttle PDF 488.6 KB Sabatini and Lander gRNA cloning into...

...50929 Plant BsaI none S. pyogenes Yang pUC gRNA Shuttle 47024 Plant inFusion none S. pyogenes Parrott pCBC-DT1T1...

...produce large amounts of a single antibody with little variation. Recombinant plasmids - Antibodies can...

... 2015. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand...

...recombination sites (attL-left- and attR-right-, Figure 1). Under certain conditions, the attL and attR sites...into an attL-entry-TOPO vector. TOPO cloning adds short end(s) to facilitate cloning into an attL-containing... and a attL-entry vector. This fragment is inserted in a multiple cloning site (MCS) of an attL-containing... attP1 sites; attB2 only with attP2, attL1 only with attR1; attL2 only with attR2, and so on. Take a look...reactions. Recombination of attP and attB sites creates attL and attR sites.   Gateway vectors contain modified... clone containing the DNA of interest flanked by attL sites. As a byproduct of the reaction, the ccdB ... BP and LR reactions. The BP reaction creates an attL-flanked entry clone. The LR reaction creates an ...

...to our guest bloggers Marcelle Tuttle and Alex Chavez! Marcelle Tuttle is a medical student at Tufts ...post was contributed by guest bloggers Marcelle Tuttle and Alex Chavez, researchers at the Wyss Institute...nmeth.3473 Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand... . https://doi.org/10.1038/nmeth.3312 Chavez A, Tuttle M, Pruitt BW, Ewen-Campen B, Chari R, Ter-Ovanesyan...

...mug or reusable water bottle, you’d probably bring in a mug or reusable water bottle instead of buying yourself...contributors to the sustainability problem, how can one little change make a difference? Individual changes to...yourself a big stack of plastic cups. By initiating little changes in ourselves, we can both influence others...

... discarded.  Seeding Labs does an amazing job shuttling unwanted lab supplies to places that really need...one point I started to become very aware of how little care I took with my discards and to be mindful ...the lab materials I was using.  I started to do little things to save reagents and money.  This was the... for smaller and smaller gel apparatus until I settled on using glass slides. With just the right amount...