Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 8 results for: ttl

Showing: 1 - 8 of 8 results

  1. Adenovirus Guide

    Type
    Guide
    ...Used to alter infectivity and tropism. pShuttle Class of shuttle/transfer vectors for recombinant adenoviral...rAdV vectors, you generally need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing...and homology regions for recombination with the shuttle plasmid. For a summary of all adenoviral plasmid...plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the..., the transgene of interest is cloned into the shuttle plasmid, verified, and linearized with the restriction...adenoviral genes necessary for virus production. The shuttle plasmid and the adenoviral backbone plasmid have...standard BJ5183 with supercoiled pAdEasy and the shuttle plasmid, but this method results in a higher background...

  2. Sequencing Primers

    Type
    Guide
    ...CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward primer pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector...

  3. Cloning

    Type
    Guide
    ...entry clone). The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now...cloned into a donor plasmid, it can be rapidly shuttled into any compatible Gateway® Destination vector...

  4. Guide to Using Pooled Libraries

    Type
    Guide
    ...winners’. Negative Screen Negative screens are a little trickier than positive screens. In a negative screen...

  5. Plan Your Experiment

    Type
    Guide
    ...DNA to serve as template for the repair. Once you settle on your gRNA, you can design a donor DNA to have...

  7. Antibody Guide

    Type
    Guide
    ...produce large amounts of a single antibody with little variation. Recombinant plasmids - Antibodies can...

  8. CRISPR Guide

    Type
    Guide
    ...Chavez, A., Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman...
Showing: 1 - 8 of 8 results