We narrowed to 392 results for: Lor

...Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging." Proceedings of the National...

...important to very important. In addition, we also explored the barriers to adoption within academic environments...

...Improving on the glutamate sensor iGluSnFR from Loren Looger’s lab, Kaspar Podgorski and colleagues have...

...Snell KD, Seo JS, Chua N-H, Strano MS (2019) Chloroplast-selective gene delivery and expression in planta...

... for Sequence‐Specific Detection of RNAs in Two Colors."ChemBioChem 17.10 (2016): 895-899. Choudhury...

...hsdR17(rK- mK+)  XL10 Gold Tetracycline and Chloramphenicol High competency cloning and propagation of ...

...nar/gkw159 Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T (2017). ...

...optogenetic tool developed for bidirectional dual-color control of neurons. Nature Communications, 12(1)...

...PBAD), and the A118 gene downstream of the diacetylphloroglucinol (DAPG)-inducible promoter (PPhlF).  Output...

...first discovered transposons due to changes in coloration of corn kernels. Aside from corn, transposons...

...171-182. PubMed PMID: 17328683. 11. Wouterlood, Floris G., et al. "A fourth generation of neuroanatomical...

...the haystack” type of problem and led to me to explore alternate approaches. Being a “lazy” geneticist...

..., to produce a series of FP-RLuc8 fusions for multicolor imaging. In all of these fusions coelenterazine...

...SMJ.0b013e3182498ad5 Curran-Everett, Douglas. Explorations in statistics: statistical facets of reproducibility...

...for Designing Primers UCSC Genome Browser: For eploring genomic DNA ImageJ: Free Software for Analyzing...

...https://doi.org/10.1021/acssynbio.3c00167. Hahn, Florian, et al. “A Modular Cloning Toolkit for Genome Editing...

... by 750 nm to 760 nm laser light, enabling dual color imaging studies with blue or cyan proteins without...

... Degorce, François, et al. "HTRF: a technology tailored for drug discovery–a review of theoretical aspects...

...below.   Figure 2: gRNA target sequences (colored rectangles) are cloned into various plasmids using...

...kits are quick, easy, and don’t involve phenol-chloroform.  The default option is to use the kit that ...

...apyrimidinic sites and abbreviated as AP sites. To explore this further, the team started engineering a CBE...

...need such precise measurements, you can use a colorimetric ladder, visible to the naked eye; a fluorescent...

...SwiChRca, Phobos, Aurora Halorhodopsins Halorhodopsins are light-gated inward chloride pumps isolated from ...species include: CsChR (from Chloromonas subdivisa ), CoChR (from Chloromonas oogama ), and SdChR (from ...Channelrhodopsin from Chloromonas oogama CsChR Channelrhodopsin from Chloromonas subdivisa CheRiff Channelrhodopsin... mutations 540 Channelrhodopsins: chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations... ReaChR variant 517 Halorhodopsins Jaws Red-shifted, light-driven inward chloride pump from Haloarcula... with light. Read this guide to learn more, or explore Addgene's Optogenetics Plasmid Collection . An ...identified in other species. By acting as light-gated chloride channels, these variants result in the hyperpolarization...

...intravenous delivery by directed evolution of underexplored sites on the AAV capsid. Molecular Therapy -...

... Here, HRP is used as a colorimetric, in which the reaction produces a colored product that accumulates...well. In colorimetric assays, protein amount can be determined by correlating the amount of color in a well...small multiplex experiments 4-color flow panel: BV421, FITC, PE, and APC 4-color microscopy panel: DAPI for...molecules , proteins that emit a measurable light or color in response to a specific stimulus, can be conjugated...than HRP, fluorophores are available in a range of colors activated by different wavelengths, allowing for...indirect or direct method. Since IF uses fluorophore color to differentiate between the targets of interest...theoretically allow for roughly fifty different fluorophore colors in flow cytometry, but the largest panels used ...

... Compound 21, deschloroclozapine (DCZ), perlapine, and olanzapine have all been explored as alternative...targeted to. Read this guide to learn more, or explore Addgene's Chemogenetics Plasmid Collection . Figure...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Kumata, K., Seki, C., … Minamimoto, T. (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...25002280 Strader, C. D., Gaffney, T., Sugg, E. E., Candelore, M. R., Keys, R., Patchett, A. A., & Dixon, R....

...fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging can be achieved by using orthogonal... L., Jung, K., McCool, R. S., Johnson, K. A., & Taylor, D. W. (2022). Structural basis for mismatch surveillance...Petris, G., Montagna, C., Reginato, G., Maule, G., Lorenzin, F., Prandi, D., Romanel, A., Demichelis, F., ...Zhang, H., Finkelstein, I. J., Johnson, K. A., & Taylor, D. W. (2024). Unraveling the mechanisms of PAMless...Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor CRISPR labeling of chromosomal loci in human ...., Ramos, D., Hibshman, G. N., Wright, J. T., & Taylor, D. W. (2023). Structural snapshots of R-loop formation...

...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin...bases and a microscope captures the fluorescent color that is emitted each time a base is added. Again... base (A,C,T, or G) is labeled with a different color, making it easy to identify the order of the DNA...

...sequencing primer" and "3' sequencing primer" or explore the sequence map in SnapGene or other software ...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...

...Modular Cloning Chloroplast Toolbox Plant Expression Scott Lenaghan 122 plasmids with chloroplast-specific genetic...