We narrowed to 253 results for: CIL
-
TypeBlog Post... researchers to expand the Fragmid toolkit to facilitate other lentivirus- and AAV-based studies. Unified...
-
Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands
TypeBlog Post...crossover to reduce ‘muddying’ of the signal and facilitate clear differentiation between multiple dyes during... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...two-photon microscopy and new constructs have facilitated the creation of mouse lines that can be used ... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post...expressed a cytidine deaminase fusion with Cas9 with a uracil DNA glycosylase inhibitor with a degradation tag... -
The CRISPR Software Matchmaker: A New Tool for Choosing the Best CRISPR Software for Your Needs
TypeBlog Post...pool of CRISPR software embodies solutions that facilitate most experimental applications in CRISPR engineering... -
15 Hot Plasmids from 2017
TypeBlog Post...libraries The Gross Lab at UCSF recently deposited 2 Bacillus subtilis libraries with Addgene – the B. subtilis... -
Troubleshooting and Optimizing a Western Blot
TypeBlog Post...straight are to mark the upper left-hand corner with a pencil (not a pen — they bleed!), cut off the upper left-hand... -
Molecular Biology Reference
TypeGuide...Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol...Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be used in place of ampicillin. Preparing Antibiotics Create...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...consists of Adenine, Cytosine, Guanine and Uracil (U). Uracil replaces thymine in RNA molecules. Every ...., a gene whose product confers resistance to ampicillin) is included in the plasmid. These bacteria are... are then grown in the presence of ampicillin. Under these conditions, there is a selective pressure to...common plasmid types: Cloning Plasmids - Used to facilitate the cloning of DNA fragments. Cloning vectors... -
Lentiviral Vector Guide
TypeGuide...target species. Although chromatin availability facilitates integration, it does not explain the lentiviral...p75 ), a lentiviral tethering gene that helps facilitate integration. Despite knowing the general preference...transduction of lentiviral vectors in order to facilitate immunotherapy and gene therapy. Biomedicine &...unspliced and partially spliced transcripts to facilitate nuclear export. Provided by a separate plasmid... -
Sequencing Primers
TypeGuide...forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward ... -
Plan Your Experiment
TypeGuide...efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific ... -
Chemogenetics Guide
TypeGuide...RHJ, DiBerto JF, et al. (2015). A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of... -
Adenovirus Guide
TypeGuide...have matching left and right homology arms which facilitate homologous recombination of the transgene into...