Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 253 results for: CIL

Showing: 241 - 253 of 253 results

  4. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...expressed and a tracrRNA (the helper RNA that facilitate the processing of the crRNA) is also expressed...

  5. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...libraries The Gross Lab at UCSF recently deposited 2 Bacillus subtilis libraries with Addgene – the B. subtilis...

  7. Molecular Biology Reference

    Type
    Guide
    ...Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol...Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be used in place of ampicillin. Preparing Antibiotics Create...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...consists of Adenine, Cytosine, Guanine and Uracil (U). Uracil replaces thymine in RNA molecules. Every ...., a gene whose product confers resistance to ampicillin) is included in the plasmid. These bacteria are... are then grown in the presence of ampicillin. Under these conditions, there is a selective pressure to...common plasmid types: Cloning Plasmids - Used to facilitate the cloning of DNA fragments. Cloning vectors...

  8. Lentiviral Vector Guide

    Type
    Guide
    ...target species. Although chromatin availability facilitates integration, it does not explain the lentiviral...p75 ), a lentiviral tethering gene that helps facilitate integration. Despite knowing the general preference...transduction of lentiviral vectors in order to facilitate immunotherapy and gene therapy. Biomedicine &...unspliced and partially spliced transcripts to facilitate nuclear export. Provided by a separate plasmid...

  9. Modular Cloning Guide

    Type
    Guide
    ...or gene editing in filamentous fungi such as Penicillium or Aspergillus species. MoClo Yeast Secretion...sets of plasmids to generate constructs for Lactiplantibacillus plantarum and other species. Ubigate Collection...

  10. Sequencing Primers

    Type
    Guide
    ...forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward ...

  11. Chemogenetics Guide

    Type
    Guide
    ...RHJ, DiBerto JF, et al. (2015). A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of...

  12. Plan Your Experiment

    Type
    Guide
    ...efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific ...

  13. Adenovirus Guide

    Type
    Guide
    ...have matching left and right homology arms which facilitate homologous recombination of the transgene into...
Showing: 241 - 253 of 253 results