Skip to main content

We narrowed to 7 results for: CIL

Showing: 1 - 7 of 7 results
  1. Molecular Biology Reference

    Type
    Guide
    ...Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol...Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used in place of ampicillin. DNA Sequencing for Plasmid...consists of Adenine, Cytosine, Guanine and Uracil (U). Uracil replaces thymine in RNA molecules. Every ...nucleotide bases as DNA, except thymine is replaced by uracil (U). Not all regions of DNA code for proteins. ... Addgene Resource(s) Cloning Plasmids Used to facilitate the cloning of DNA fragments. Cloning vectors...Nucleobase A Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase ...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...target species. Although chromatin availability facilitates integration, it does not explain the lentiviral...p75 ), a lentiviral tethering gene that helps facilitate integration. Despite knowing the general preference...transduction of lentiviral vectors in order to facilitate immunotherapy and gene therapy. Biomedicine &...unspliced and partially spliced transcripts to facilitate nuclear export. Provided by a separate plasmid...
  3. Modular Cloning Guide

    Type
    Guide
    ...or gene editing in filamentous fungi such as Penicillium or Aspergillus species. MoClo Yeast Secretion...sets of plasmids to generate constructs for Lactiplantibacillus plantarum and other species. Ubigate Collection...
  4. Sequencing Primers

    Type
    Guide
    ... Forward Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...
  5. Chemogenetics Guide

    Type
    Guide
    ...Krashes, M. J., … Roth, B. L. (2015). A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of...
  6. Plan Your Experiment

    Type
    Guide
    ...efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific ...
  7. Adenovirus Guide

    Type
    Guide
    ...have matching left and right homology arms which facilitate homologous recombination of the transgene into...
Showing: 1 - 7 of 7 results