Skip to main content
Addgene

We narrowed to 6 results for: CIL

Showing: 1 - 6 of 6 results
  1. Molecular Biology Reference

    Type
    Guide
    ...Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol...Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be used in place of ampicillin. Preparing Antibiotics Create...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...consists of Adenine, Cytosine, Guanine and Uracil (U). Uracil replaces thymine in RNA molecules. Every ...., a gene whose product confers resistance to ampicillin) is included in the plasmid. These bacteria are... are then grown in the presence of ampicillin. Under these conditions, there is a selective pressure to...common plasmid types: Cloning Plasmids - Used to facilitate the cloning of DNA fragments. Cloning vectors...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...target species. Although chromatin availability facilitates integration, it does not explain the lentiviral...p75 ), a lentiviral tethering gene that helps facilitate integration. Despite knowing the general preference...transduction of lentiviral vectors in order to facilitate immunotherapy and gene therapy. Biomedicine &...unspliced and partially spliced transcripts to facilitate nuclear export. Provided by a separate plasmid...
  3. Sequencing Primers

    Type
    Guide
    ...forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward ...
  4. Plan Your Experiment

    Type
    Guide
    ...efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific ...
  5. Chemogenetics Guide

    Type
    Guide
    ...RHJ, DiBerto JF, et al. (2015). A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of...
  6. Adenovirus Guide

    Type
    Guide
    ...have matching left and right homology arms which facilitate homologous recombination of the transgene into...
Showing: 1 - 6 of 6 results