Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 396 results for: promoter

Showing: 281 - 300 of 396 results

  1. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...

  2. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  3. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  4. Lentivirus Plasmids

    Type
    Collection
    ...shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR. Any expression cassette (promoter and gene of interest) can be cloned into the plasmid.... Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection. See Campeau et al. (2009...

  5. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Gene/Insert Promoter PI Publication Return to top Bacteria ID Plasmid Gene/Insert Promoter PI Publication...Publication Return to top Plant ID Plasmid Gene/Insert Promoter PI Publication Return to top CRISPR Resources ...

  6. PhD Applications After COVID

    Type
    Blog Post
    ...feasible. Through the virtual systems created and promoted during COVID-19, online meetings with current ...

  10. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...a requirement. Your manager: Unlike academia, promotions in industry are based on people’s ability to ...

  12. mTOR Pathway

    Type
    Collection
    ...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth... which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR Pathway ...

  13. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...plasmid (Loqué et al., 2007) containing the PMA1 promoter and the URA3 marker, the p415 plasmid (Loqué et... et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km plasmid (Vickers et...et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid Gene/Insert Selectable...

  14. Synthetic Biology - Overview

    Type
    Collection
    ... and synthetic regulatory elements, including promoters, terminators, repressors, activators, and more...Featured SynBio Deposits Alper Lab Y. Lipolytica Promoters Anderson Lab Plasmids and Phagemids Balazsi Lab...Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit Gray Lab Maize...

  18. Lab to Office Culture Shock

    Type
    Blog Post
    ...be these skills that get you your next job or promotion. Also, don’t wait until you’re out of the lab ...

  20. Hot Plasmids: Summer 2025

    Type
    Blog Post
    ...that encodes ISYmu1 and an ωRNA under the same promoter, they introduced heritable genome edits in a single...
Showing: 281 - 300 of 396 results