We narrowed to 326 results for: virus

...HDR. PASTE is also compatible with both AAV and adenovirus templates. The system, which is larger than Cas9...

...floating. In the same paper, the authors used lentivirus to introduce an shRNA to downregulate expression...

...focusing on my technical skills with cloning and lentivirus production, I didn’t really start to recognize...

...Seroogy, C. (2017). Neonatal immune response to rhinovirus A16 has diminished dendritic cell function and...

... to target multiple delivery systems, such as lentivirus and MMLV gag, to specific cell types. It can ...

...replication machinery of Kaposi’s sarcoma-associated herpesvirus.       References 1. Snapp, Erik. "Design and...

...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...infectious diseases such as COVID-19, Ebola virus, and Zika virus. Chimpanzee adenoviral (ChAdV) vectors have...2021). Adenovirus biology, recombinant adenovirus, and adenovirus usage in gene therapy . Viruses, 13 (...Browse Adenoviral Plasmids Adenovirus versus Adeno-Associated Virus Adenoviruses fall under the Adenoviridae...Elements Glossary Credits Adenoviruses (AdV) are medium-sized, non-enveloped viruses containing a linear double-stranded.... Characterization of a Species E Adenovirus Vector as a Zika virus vaccine . Scientific Reports, 10 (...Matsunaga, W., & Gotoh, A. (2023). Adenovirus as a vector and oncolytic virus . Current Issues in Molecular...

...proliferation of leukemia cells, and assembly of adenovirus particles (Zhang et al., 2025). Figure...

...types of lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency virus (BIV), and... that a virus can infect and replicate in. Viral vector The modified form of a wild-type virus used to..., like viruses or bacteria, within a host organism, leading to disease. Lentivirus A retrovirus from the... and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability to...and accessory genes specific to each virus type, while retroviruses only contain packaging genes. From ...different viruses and require different isoforms of these packaging components. Therefore, lentivirus may not...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific...

...constructs were designed to be packaged into a retrovirus for infection of host cells. The fluorescent ...

... for Your Experiments Get Ready-to-Use CRISPR Lentivirus ...

...Murine stem cell virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse pBABE...Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC...Murine leukemia virus (MuLV) Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma virus (RSV) env gene...-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus (MoMuLV) LTR Forward mPGK-F CATTCTGCACGCTTCAAAAG...(MSCV) CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT...Forward pREP Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA...SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG SP6 promoter...

...our CRISPR guide pages Find ready-to-use Cas9 lentivirus ...

...expand the Fragmid toolkit to facilitate other lentivirus- and AAV-based studies. Unified MoClo Systems...

...upon the CRISPR family of plasmids by offering a lentivirus-based mechanism for sgRNA delivery and providing...

...types of viruses that are commonly used in research, including: Lentivirus Adeno-associated Virus (AAV) ...) Adenovirus γ-Retrovirus Read More...

...analyses to pinpoint genes linked to parasite virulence, transmission, and development. This collection...

...Hexahistidine tag with Thrombin cleavage, Bac-to-Bac Baculovirus Expresion vector 26117 pNIC-CH EF199843 Hexahistidine...

...applications in molecular biology, plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation...

...mouse models. For viral injection, Adeno-associated virus (AAV) is a widely-used tool for achieving in vivo... especially useful in AAV experiments where the virus can spread around the injection site and potentially...