Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 323 results for: virus

Showing: 301 - 320 of 323 results

  2. Lab to Office Culture Shock

    Type
    Blog Post
    ...focusing on my technical skills with cloning and lentivirus production, I didn’t really start to recognize...

  4. Adenovirus Guide

    Type
    Guide
    ...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...infectious diseases such as COVID-19, Ebola virus, and Zika virus. Chimpanzee adenoviral (ChAdV) vectors have...2021). Adenovirus biology, recombinant adenovirus, and adenovirus usage in gene therapy . Viruses, 13 (...plasmids available at Addgene. Adenovirus versus Adeno-Associated Virus Adenoviruses fall under the Adenoviridae...Plasmid Elements Glossary Adenoviruses (AdV) are medium-sized, non-enveloped viruses containing a linear double-stranded.... Characterization of a Species E Adenovirus Vector as a Zika virus vaccine . Scientific Reports, 10 (...Matsunaga, W., & Gotoh, A. (2023). Adenovirus as a vector and oncolytic virus . Current Issues in Molecular...

  6. Lentiviral Vector Guide

    Type
    Guide
    ...types of lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency virus (BIV), and... that a virus can infect and replicate in. Viral vector The modified form of a wild-type virus used to..., like viruses or bacteria, within a host organism, leading to disease. Lentivirus A retrovirus from the... and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability to...and accessory genes specific to each virus type, while retroviruses only contain packaging genes. From ...different viruses and require different isoforms of these packaging components. Therefore, lentivirus may not...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific...

  10. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse primer...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg...-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG...CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...Forward GCTCGATACAATAAACGCC (Invitrogen) Rous sarcoma virus (RSV) promoter, forward primer pRS-marker CGGCATCAGAGCAGATTGTA...primer pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG...ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of Rous sarcoma virus (RSV) env gene, forward primer Rluc-F CCAGGATTCTTTTCCAATGC...

  11. Guide to Using Pooled Libraries

    Type
    Guide
    ...the plasmids must first be used to make virus. This pooled virus is subsequently used to deliver the plasmids...electroporation and maxiprep). If delivering as virus, make virus; this creates a pooled lentiviral CRISPR library...

  13. CRISPR Plasmids - Parasites

    Type
    Collection
    ...analyses to pinpoint genes linked to parasite virulence, transmission, and development. This collection...

  15. Science Guides

    Type
    Guide
    ...types of viruses that are commonly used in research, including: Lentivirus Adeno-associated Virus (AAV) ...) Adenovirus γ-Retrovirus Read More...

  17. Educational Resources

    Type
    Guide
    ...applications in molecular biology, plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation...

  18. Chemogenetics Guide

    Type
    Guide
    ...mouse models. For viral injection, Adeno-associated virus (AAV) is a widely-used tool for achieving in vivo... especially useful in AAV experiments where the virus can spread around the injection site and potentially...

  19. Optogenetics Guide

    Type
    Guide
    ...localized expression of the opsin. Depending on the virus and promoter system used, there is an incubation...Sabatini BL 2012. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression...

  20. CRISPR Guide

    Type
    Guide
    ... be efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9...editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the...H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace" ...need to generate lentivirus containing the entire library (Figure 8D). This lentivirus will then be used...delivery to cells that are poorly transduced by lentivirus. Non-mammalian CRISPR libraries are also available...as liquid DNA, or in select cases, as pre-made lentivirus . DNA libraries are shipped at a concentration...need to either co-infect with a Cas9-producing lentivirus or use a Cas9-expressing stable cell line. After...
Showing: 301 - 320 of 323 results