Skip to main content

We narrowed to 14 results for: virus

Showing: 1 - 14 of 14 results
  1. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...deficient and depend on other viruses such as adenovirus or herpes simplex virus to replicate in the host ...Glossary Credits Adeno-Associated Viruses (AAV) are small, non-enveloped viruses containing a small, linear ...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...Tropism Adeno Associated Virus (AAV) for Cell and Gene Therapy Adeno-associated Viruses (AAVs) for Genome Editing...Definition Adeno-associated virus (AAV) Wildtype, small, nonenveloped viruses from the Parvoviridae family...replication process where the virus uses the cell machinery to produce new viruses, eventually lysing the cell...Browse AAV Plasmids Adeno-Associated Virus versus Adenovirus Adenoviruses (AdV) are part of the Adenoviridae...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...leukemia virus (MLV), murine sarcoma virus (MSV), and feline leukemia virus (FeLV). Retroviruses are partially...Gibbon Ape Leukemia Virus (GALV) — T and B cell transduction Murine Leukemia Virus (MuLV) and HIV glycoprotein... that a virus can infect and replicate in. Viral vector The modified form of a wild-type virus used to...packaging genes, while lentiviruses also contain accessory genes specific to each virus type. From an experimental...pathogen, like viruses or bacteria, within a host organism, leading to disease. Provirus The genetic material...packaging genes. However, they are different viruses and require different isoforms of these packaging components...to wide infectivity VSV-G (vesicular stomatitis virus G protein) is the most common envelope gene, due...
  3. Adenovirus Guide

    Type
    Guide
    ...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...infectious diseases such as COVID-19, Ebola virus, and Zika virus. Chimpanzee adenoviral (ChAdV) vectors have...2021). Adenovirus biology, recombinant adenovirus, and adenovirus usage in gene therapy . Viruses, 13 (...Browse Adenoviral Plasmids Adenovirus versus Adeno-Associated Virus Adenoviruses fall under the Adenoviridae...Elements Glossary Credits Adenoviruses (AdV) are medium-sized, non-enveloped viruses containing a linear double-stranded.... Characterization of a Species E Adenovirus Vector as a Zika virus vaccine . Scientific Reports, 10 (...Matsunaga, W., & Gotoh, A. (2023). Adenovirus as a vector and oncolytic virus . Current Issues in Molecular...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...types of lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency virus (BIV), and... that a virus can infect and replicate in. Viral vector The modified form of a wild-type virus used to..., like viruses or bacteria, within a host organism, leading to disease. Lentivirus A retrovirus from the... and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability to...and accessory genes specific to each virus type, while retroviruses only contain packaging genes. From ...different viruses and require different isoforms of these packaging components. Therefore, lentivirus may not...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific...
  5. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse pBABE...Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC...Murine leukemia virus (MuLV) Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma virus (RSV) env gene...-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus (MoMuLV) LTR Forward mPGK-F CATTCTGCACGCTTCAAAAG...(MSCV) CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT...Forward pREP Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA...SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG SP6 promoter...
  6. Science Guides

    Type
    Guide
    ...types of viruses that are commonly used in research, including: Lentivirus Adeno-associated Virus (AAV) ...) Adenovirus γ-Retrovirus Read More...
  7. Educational Resources

    Type
    Guide
    ...applications in molecular biology, plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation...
  8. Chemogenetics Guide

    Type
    Guide
    ...mouse models. For viral injection, Adeno-associated virus (AAV) is a widely-used tool for achieving in vivo... especially useful in AAV experiments where the virus can spread around the injection site and potentially...
  9. Promoters

    Type
    Guide
    ...Constitutive Plant Strong promoter from Cauliflower Mosaic Virus Ubi Constitutive Plant High-expression promoter ...Polyhedrin Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter...
  10. CRISPR Guide

    Type
    Guide
    ... be efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9...editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the...H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace" ...need to generate lentivirus containing the entire library (Figure 8D). This lentivirus will then be used...delivery to cells that are poorly transduced by lentivirus. Non-mammalian CRISPR libraries are also available...as liquid DNA, or in select cases, as pre-made lentivirus . DNA libraries are shipped at a concentration...need to either co-infect with a Cas9-producing lentivirus or use a Cas9-expressing stable cell line. After...
  11. Plan Your Experiment

    Type
    Guide
    ...CRISPR delivery, lentiviral and adeno-associated virus (AAV) vectors are the most common. Using viral vectors...into your viral vector) is smaller than that of lentivirus. Thus, AAVs are generally only compatible with...
  12. Optogenetics Guide

    Type
    Guide
    ...localized expression of the opsin. Depending on the virus and promoter system used, there is an incubation...
  13. Modular Cloning Guide

    Type
    Guide
    ...multigene expression vectors for expression in baculovirus or S. cerevisiae . Compatible with MoClo-YTK ...
Showing: 1 - 14 of 14 results