We narrowed to 369 results for: reporter
-
TypeBlog Post..., et al. "One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated...
-
Hot Plasmids: Summer 2024
TypeBlog Post...Integrase Gene Editing (PASSIGE), their previously-reported technique for precisely integrating large DNA ... -
Finding Your Science Policy Path
TypeBlog Post...science policy skills in graduate school via this report from the Scientific Citizenship Initiative. ... -
Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus
TypeBlog Post...Large Gene Cassettes Using AAV Donor Vectors. Cell Reports 20:750–756 . https://doi.org/10.1016/j.celrep.2017.06.064... -
Important Considerations When Using AAVs
TypeBlog Post... complexes to study neural function. Often the reporter proteins associated with these complexes are so... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...), and ability to metastasize. There have been reports of clinical trials going amiss and patient deaths... -
Antibodies 101: Flow Cytometry
TypeBlog Post...tag your protein of interest with a fluorescent reporter on the N- or C-terminus of the protein. One downside... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...protein kinase dynamics in living cells with FRET reporters." Methods 40.3 (2006): 279-286. PubMed PMID: 16908183... -
CRISPR Guide
TypeGuide...and a ssDNA-fluorescently quenched reporter is added. As this reporter is degraded by Cas12a, it will release... using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to the reaction... target sequence, it promiscuously cleaves the reporter as well, and a quantifiable signal is produced...all-in-one CRISPR/Cas9 vector system. Scientific Reports , 4 (1). PMID: 24954249 Shechner, D. M., Hacisuleyman...mapping multiprotein complexes in human cells. Cell Reports . 13 (3), 621–633. PMID: 26456817 Doench, J. G.... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog Post...second. The first successful irreversible PA-FP reported was PA-GFP. PA-GFP was derived from Jellyfish ... -
Validated gRNA Sequences
TypeCollection...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ... -
CRISPR 101: Cytosine Transversion Editors
TypeBlog Post...Adenine Base Editors Read about four base editor reporters CRISPR 101: Prime Editing CRISPR 101: Cas9 Structural... -
Antibody Validation for Flow Cytometry
TypeBlog Post... specific detection of human TRPA1. Scientific Reports, 9(1), 18500. https://doi.org/10.1038/s41598-019... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...insulin-producing β-like-cells [37, 38]. In 1987, Davis et al. reported one of the earliest examples of transdifferentiation... -
Chemogenetics Guide
TypeGuide...control expression of a chemogenetic reporter ensures that the reporter remains silent until a cell or tissue-specific... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post.... (2013). One-Step generation of mice carrying reporter and conditional alleles by CRISPR/CAS-Mediated... -
Guide to Using Pooled Libraries
TypeGuide...die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those cells that... -
Molecular Biology Reference
TypeGuide...TALEN Plasmids and Kits , Genome Engineering Kits Reporter Plasmids Used for studying the function of genetic...genetic elements. These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol...and unlike other density gradient media, it is reportedly not necessary to remove iodixanol prior to use... -
CRISPR 101: Cytosine and Adenine Base Editors
TypeBlog Post...editing for plants Read about four base editor reporters Additional Resources on Addgene.org Catch up...