We narrowed to 361 results for: reporter
-
TypeBlog Post... complexes to study neural function. Often the reporter proteins associated with these complexes are so...
-
Antibodies 101: Flow Cytometry
TypeBlog Post...tag your protein of interest with a fluorescent reporter on the N- or C-terminus of the protein. One downside... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...), and ability to metastasize. There have been reports of clinical trials going amiss and patient deaths... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...protein kinase dynamics in living cells with FRET reporters." Methods 40.3 (2006): 279-286. PubMed PMID: 16908183... -
Chemogenetics Guide
TypeGuide...control expression of a chemogenetic reporter ensures that the reporter remains silent until a cell or tissue-specific... -
Validated gRNA Sequences
TypeCollection...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ... -
Guide to Using Pooled Libraries
TypeGuide...die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those cells that... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog Post...second. The first successful irreversible PA-FP reported was PA-GFP. PA-GFP was derived from Jellyfish ... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...insulin-producing β-like-cells [37, 38]. In 1987, Davis et al. reported one of the earliest examples of transdifferentiation... -
CRISPR 101: Cytosine Transversion Editors
TypeBlog Post...Adenine Base Editors Read about four base editor reporters CRISPR 101: Prime Editing CRISPR 101: Cas9 Structural... -
Antibody Validation for Flow Cytometry
TypeBlog Post... specific detection of human TRPA1. Scientific Reports, 9(1), 18500. https://doi.org/10.1038/s41598-019... -
Molecular Biology Reference
TypeGuide...information on CRISPR check out Addgene’s CRISPR guide . Reporter Plasmids - Used for studying the function of genetic... genetic elements. These plasmids contain a reporter gene (for example, luciferase or GFP) that offers... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol...and unlike other density gradient media, it is reportedly not necessary to remove iodixanol prior to use... -
CRISPR 101: Cytosine and Adenine Base Editors
TypeBlog Post...editing for plants Read about four base editor reporters Additional Resources on Addgene.org Catch up... -
Troubleshooting and Optimizing a Western Blot
TypeBlog Post...blot, you may want to consider using a different reporter or, if you don’t need to compare the protein amounts... -
Gamma-Retroviral Vector Guide
TypeGuide...the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker... -
Optogenetics Guide
TypeGuide...optical switches Sensors are genetically-encoded reporters of molecular signals; e.g., calcium indicators... -
Adenovirus Guide
TypeGuide...Adenovirus Vector as a Zika virus vaccine . Scientific Reports, 10 (1), 3613. https://doi.org/10.1038/s41598-020... -
Lentiviral Vector Guide
TypeGuide...the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker... -
Viral Vectors 101: Systemic Capsids
TypeBlog Post...expression from mouse to primate neocortex. Cell Reports, 34(13). https://doi.org/10.1016/j.celrep.2021.108754...