Skip to main content
Addgene
Showing: 361 - 380 of 559 results
  1. Summer SciComm: Science Storytelling

    Type
    Blog Post
    ...forces or (2) the result of competing desires or (3) the presence of obstacles that need to be overcome...formal scientific communications, they are fantastic fodder for science communication. The trick is to ... is far from the only way to communication science. Science communicators also use the hero’s journey,...this small glimpse into the world of science communication and can use what you've learned to share your...Finding Conflict in Science  In all science communication, what you are doing is telling a (nonfiction...details often aren’t included in scientific communications, but they’re firmly part of the story to the...conflict gives you an easy framework with which to communicate your science. The act of building towards your...
  2. 10 Ways to Share Your Science!

    Type
    Blog Post
    ...out science blogs written by practicing scientists. 3)   Consider starting up your own twitter feed or talking... Foundation Round Table. In any field, good communication skills help when it comes to finding a job. ...an argument for taking the time to hone your communication skills. So, where can a graduate student or ...opportunities than ever before for scientists to communicate about their work and their interest in science...your area or at your institution; the news or communications office is a good place to start. It’s not unusual...about science writing as a career, the Science Communication Program at the University of California, Santa... your research stories. Consider practicing communicating your research by guest blogging here, just leave...
  3. Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi

    Type
    Blog Post
    ...yellow fluorescent protein at the time. It is 1.5 to 3 times brighter than the most commonly used GFPs and...fluorescent protein: identification of the molecular determinants of color and applications in fluorescence... be used as a fusion tag for a wide range of applications from traditional imaging to FRET and stochastic...492 nm, respectively), they gave this a teal classification rather than cyan and named the protein mTFP1...the fusion protein localized to their expected locations. An analysis of mWasabi gave similar results. ...fluorescent protein: structural characterization and applications in fluorescence imaging." Biochemical Journal...
  4. Tips for Improving Your Next Manuscript

    Type
    Blog Post
    ... is not prose; it is to be straight to the point. 3. Engage the reader Scientists forget that the reader...of any scientist’s career. We use writing to communicate our findings and share them with the world. If...simply writing down your data doesn’t guarantee a publication. There is an art to composing manuscripts and...field of microbiology with multiple high-profile publications. My classmates consisted of graduate students...well as being critiqued added an extra level of application not present in the online class.   Four ways ...paper will be generated. After you complete a publication quality figure, produce the figure, its legend...
  5. Choosing Your Perfect Empty Backbone

    Type
    Blog Post
    ...vector expressing a selection cassette with 5′ and 3′ flanking sequences matching the sequences upstream... (e.g. 6xHis containing pDEST-HisMBP). After purification the protein can be released from the resin and...types of yeast expression vectors. Consider your applications and experimental design. You can create a new...more traditional approach of an autonomously replicating vector that carries either a wild-type version...a variety of other types of vectors for most applications used to study gene function. From making transgenic...transgenic animals, gene targeting and genome modifications to reporter vectors (e.g. pBV-Luc) and gene ...
  6. Comparing Cas9 to NgAgo: Can the Argonautes Best CRISPR?

    Type
    Blog Post
    ... PMC4697943. Find plasmids from this publication at Addgene. 3. Swarts, Daan C., et al. “Argonaute of...template is supplied. Find Plasmids from the NgAgo Publication at Addgene Cas9 and NgAgo head to head NgAgo ...differences in cleavage efficiency. If this finding is replicated in larger studies, it will represent a key advantage...site specified by the gDNA. Depending on your application, this could be favorable or unfavorable. In a...PubMed PMID: 27136078. Find plasmids from this publication at Addgene. 2. Swarts, Daan C., et al.  “DNA-...
  7. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ...current with the latest and greatest! Addgene resources 3 Tips to Improve HDR Efficiency for CRISPR Editing ...the gRNA design process and rules for various applications is necessary going forward. The standardization... I think I may have finally grasped just how complicated DNA repair pathways are. I fully admit to being...Alt-NHEJ), has been harnessed for CRISPR knock-in applications. CRISPR 101: Targeting RNA with Cas13a (C2c2...for CRISPR Genome Editing Other resources and publications CRISPOR gRNA design tool Researchers at the ...
  8. Behind-the-scenes of the Isolation of the Thermostable IgnaviCas9 From a Yellowstone Hot Spring

    Type
    Blog Post
    ...to safely get back to our lab work. Figure 3: When a bison wanders into the campsite, leave your...under harsh conditions. One example application from the publication is the removal of unwanted cDNA derived...the van der Oost lab. Phylogenetic comparison indicates that like GeoCas9 and ThermoCas9, IgnaviCas9 is...a thermostable Cas9 be useful? It can enable applications where reagents must be stored at elevated temperatures...
  9. Addgene's Top 10 Blog Posts of 2015

    Type
    Blog Post
    ...scoop from Addgenie A. Max Juchheim in this post. 3. Plasmids 101: E. coli Strains for Protein Production...overjoyed to provide you with these fantastic educational resources and will be sure to keep our eyes open...used to generate inversions, deletions, and translocations. It also provides researchers with many different...repository use Cas9 to cut DNA, Addgene Science Communications Intern Mary Gearing explains how Cas9 homolog...make it easier to make gene edits at new genomic locations. 6. CRISPR 101: Non-homologous End Joining So ...
  10. Five Questions to Ask If You're Deciding Between a Master's or PhD Program

    Type
    Blog Post
    ...preparation, and lead your own research project.  3. Do you prefer being a generalist? Working on a variety...technical know-how, and helped develop my science communication skills. Ultimately, my degree prepared me to...technical or product support specialist,” “field application scientist,” or “scientific or technical writer...for PhD applicants since many will also accept applications from master’s candidates with experience.  Use...
  11. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...Palindromic Repeats, in Pubmed returned 728 articles (3/12/2014). With so many options for CRISPR plasmid ...with the newest CRISPR technologies and their applications can be exhausting. A quick search for "CRISPR...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...
  12. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ... of 10 or more plasmids.       Figure 3: If submitting plasmid(s) online (left), choose to... Enter information about the gene/insert(s). Step 3: Cloning Information Please enter the name of the ...in PubMed and choose the appropriate publication. This publication will be listed at the top of the final...classified in multiple categories, please check all of the appropriate categories (e.g., for a lentiviral... "Published plasmids" or "Unpublished or pre-publication plasmids" and set a desired distribution status...quickly associate your plasmids with the original publication where you described them. Search for your article...plasmids. You can submit "Unpublished or pre-publication plasmids": Unpublished plasmids or plasmids that...
  13. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...three systems to analyze single cells from a mixture (3): An optics system A fluidics system An electronics...expression. A routine flow cytometry experiment uses 2 or 3 different fluorescent colors each measuring a different... it passes through and scatters in different directions. The degree of scatter is captured by detectors...Light that scatters sideways to the path that it was initially traveling is called side scatter (SSC) and...granulocytes in a plot of forward scatter (FSC) versus side scatter (SSC). Users can gate around their...protein composition. It is used for a variety of applications such as measuring target protein expression ...expression levels, assessing post-translational modifications, determining cell health, analyzing cell cycle stages...
  14. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...CCGCGCGG GTTAAC CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source... vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate...
  15. Addgene's a Nonprofit? Nonprofit Awareness Day 2017

    Type
    Blog Post
    ...under the United States Internal Revenue Code 501(c)(3). That means we were formed to benefit the public,... curation, technical service and open-access educational resources. What is a nonprofit? The term "nonprofit...
  16. Single-cell tracking of lineage and identity with CellTag

    Type
    Blog Post
    ...identifier for individual cells. Each cell is labeled with 3-4 tags to increase the diversity of the CellTag library...not silenced.    Find CellTag libraries here!  Applications of CellTag The Morris Lab developed CellTag ...
  17. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type
    Blog Post
    ...-mediated marker excision, it takes approximately 3-4 weeks to obtain a homozygous, outcrossed knock-in...produced a higher editing efficiency, while for edits 3’ to the PAM sequences corresponding to the opposite...Mello lab also reported that modifying the 5’ modification of oligos used to generate linear dsDNA repair...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...Forstemann K (2014) Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination...Watts JK, Sontheimer EJ, Mello CC (2018) 5′ Modifications Improve Potency and Efficacy of DNA Donors for...Colaiácovo MP (2013) Heritable Custom Genomic Modifications inCaenorhabditis elegansvia a CRISPR–Cas9 System...
  18. Which Fluorescence Microscopy Techniques is Best for Me?

    Type
    Blog Post
    ...(i.e. optical sectioning (2) or super-resolution (3). Fluorescence microscopy techniques   Fluorescent...methods 2, 920-931 (2005). PubMed PMID: 16299477. 3. Eggeling C, Willig KI, Sahl SJ, Hell SW. Lens-based...light path. Each hole corresponds to a different location in the sample. As more than one hole is illuminated...questions will place each sample into one of four categories that are each suited to different types of modern...as spinning disk confocal. However, due to the scattering nature of biological tissue, imaging more than... allow for multi-view imaging can image thick scattering samples in their entirety, something that is ...
  19. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...tagged with different fluorescent proteins or dyes. 3. Two-photon microscopy Two-photon excitation microscopy...PMID: 18718768. PubMed Central PMCID: PMC2569002. 3. Egen, Jackson G., et al. "Macrophage and T cell dynamics... required for a growing organism to make the complicated transition from a clump of cells to a fully differentiated...relatively little tissue absorption, weak tissue scattering and small amounts of tissue auto-fluorescence...
  20. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ...fluorophore's excitation spectra around 640 nm (Figure 3), we see that APC-Cy7 is excited at a lower efficiency...cannot be excited at this wavelength. Figure 3: Excitation and emission spectra for APC and APC-Cy7...reporter, such as GFP or mCherry, through genetic modification. As your protein of interest will only occur...excitation and emission. The visible color spectrum is located in a range of wavelengths of about 380–700 nm. ...
Showing: 361 - 380 of 559 results