Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 563 results for: cat.3

Showing: 361 - 380 of 563 results

  1. Tips for Improving Your Next Manuscript

    Type
    Blog Post
    ... is not prose; it is to be straight to the point. 3. Engage the reader Scientists forget that the reader...of any scientist’s career. We use writing to communicate our findings and share them with the world. If...simply writing down your data doesn’t guarantee a publication. There is an art to composing manuscripts and...field of microbiology with multiple high-profile publications. My classmates consisted of graduate students...well as being critiqued added an extra level of application not present in the online class.   Four ways ...paper will be generated. After you complete a publication quality figure, produce the figure, its legend...

  2. Choosing Your Perfect Empty Backbone

    Type
    Blog Post
    ...vector expressing a selection cassette with 5′ and 3′ flanking sequences matching the sequences upstream... (e.g. 6xHis containing pDEST-HisMBP). After purification the protein can be released from the resin and...types of yeast expression vectors. Consider your applications and experimental design. You can create a new...more traditional approach of an autonomously replicating vector that carries either a wild-type version...a variety of other types of vectors for most applications used to study gene function. From making transgenic...transgenic animals, gene targeting and genome modifications to reporter vectors (e.g. pBV-Luc) and gene ...

  3. Comparing Cas9 to NgAgo: Can the Argonautes Best CRISPR?

    Type
    Blog Post
    ... PMC4697943. Find plasmids from this publication at Addgene. 3. Swarts, Daan C., et al. “Argonaute of...template is supplied. Find Plasmids from the NgAgo Publication at Addgene Cas9 and NgAgo head to head NgAgo ...differences in cleavage efficiency. If this finding is replicated in larger studies, it will represent a key advantage...site specified by the gDNA. Depending on your application, this could be favorable or unfavorable. In a...PubMed PMID: 27136078. Find plasmids from this publication at Addgene. 2. Swarts, Daan C., et al.  “DNA-...

  4. Behind-the-scenes of the Isolation of the Thermostable IgnaviCas9 From a Yellowstone Hot Spring

    Type
    Blog Post
    ...to safely get back to our lab work. Figure 3: When a bison wanders into the campsite, leave your...under harsh conditions. One example application from the publication is the removal of unwanted cDNA derived...the van der Oost lab. Phylogenetic comparison indicates that like GeoCas9 and ThermoCas9, IgnaviCas9 is...a thermostable Cas9 be useful? It can enable applications where reagents must be stored at elevated temperatures...

  5. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ...current with the latest and greatest! Addgene resources 3 Tips to Improve HDR Efficiency for CRISPR Editing ...the gRNA design process and rules for various applications is necessary going forward. The standardization... I think I may have finally grasped just how complicated DNA repair pathways are. I fully admit to being...Alt-NHEJ), has been harnessed for CRISPR knock-in applications. CRISPR 101: Targeting RNA with Cas13a (C2c2...for CRISPR Genome Editing Other resources and publications CRISPOR gRNA design tool Researchers at the ...

  6. Addgene's Top 10 Blog Posts of 2015

    Type
    Blog Post
    ...scoop from Addgenie A. Max Juchheim in this post. 3. Plasmids 101: E. coli Strains for Protein Production...overjoyed to provide you with these fantastic educational resources and will be sure to keep our eyes open...used to generate inversions, deletions, and translocations. It also provides researchers with many different...repository use Cas9 to cut DNA, Addgene Science Communications Intern Mary Gearing explains how Cas9 homolog...make it easier to make gene edits at new genomic locations. 6. CRISPR 101: Non-homologous End Joining So ...

  7. Five Questions to Ask If You're Deciding Between a Master's or PhD Program

    Type
    Blog Post
    ...preparation, and lead your own research project.  3. Do you prefer being a generalist? Working on a variety...technical know-how, and helped develop my science communication skills. Ultimately, my degree prepared me to...technical or product support specialist,” “field application scientist,” or “scientific or technical writer...for PhD applicants since many will also accept applications from master’s candidates with experience.  Use...

  8. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...CCGCGCGG GTTAAC CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source... vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate...

  9. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...three systems to analyze single cells from a mixture (3): An optics system A fluidics system An electronics...expression. A routine flow cytometry experiment uses 2 or 3 different fluorescent colors each measuring a different... it passes through and scatters in different directions. The degree of scatter is captured by detectors...Light that scatters sideways to the path that it was initially traveling is called side scatter (SSC) and...granulocytes in a plot of forward scatter (FSC) versus side scatter (SSC). Users can gate around their...protein composition. It is used for a variety of applications such as measuring target protein expression ...expression levels, assessing post-translational modifications, determining cell health, analyzing cell cycle stages...

  10. Addgene's a Nonprofit? Nonprofit Awareness Day 2017

    Type
    Blog Post
    ...under the United States Internal Revenue Code 501(c)(3). That means we were formed to benefit the public,... curation, technical service and open-access educational resources. What is a nonprofit? The term "nonprofit...

  11. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type
    Blog Post
    ...-mediated marker excision, it takes approximately 3-4 weeks to obtain a homozygous, outcrossed knock-in...produced a higher editing efficiency, while for edits 3’ to the PAM sequences corresponding to the opposite...Mello lab also reported that modifying the 5’ modification of oligos used to generate linear dsDNA repair...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...Forstemann K (2014) Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination...Watts JK, Sontheimer EJ, Mello CC (2018) 5′ Modifications Improve Potency and Efficacy of DNA Donors for...Colaiácovo MP (2013) Heritable Custom Genomic Modifications inCaenorhabditis elegansvia a CRISPR–Cas9 System...

  12. Single-cell tracking of lineage and identity with CellTag

    Type
    Blog Post
    ...identifier for individual cells. Each cell is labeled with 3-4 tags to increase the diversity of the CellTag library...not silenced.    Find CellTag libraries here!  Applications of CellTag The Morris Lab developed CellTag ...

  13. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ...(i.e. optical sectioning (2) or super-resolution (3). Fluorescence microscopy techniques   Fluorescent...methods 2, 920-931 (2005). PubMed PMID: 16299477. 3. Eggeling C, Willig KI, Sahl SJ, Hell SW. Lens-based...light path. Each hole corresponds to a different location in the sample. As more than one hole is illuminated...questions will place each sample into one of four categories that are each suited to different types of modern...as spinning disk confocal. However, due to the scattering nature of biological tissue, imaging more than... allow for multi-view imaging can image thick scattering samples in their entirety, something that is ...

  14. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...tagged with different fluorescent proteins or dyes. 3. Two-photon microscopy Two-photon excitation microscopy...PMID: 18718768. PubMed Central PMCID: PMC2569002. 3. Egen, Jackson G., et al. "Macrophage and T cell dynamics... required for a growing organism to make the complicated transition from a clump of cells to a fully differentiated...relatively little tissue absorption, weak tissue scattering and small amounts of tissue auto-fluorescence...

  15. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ...fluorophore's excitation spectra around 640 nm (Figure 3), we see that APC-Cy7 is excited at a lower efficiency...cannot be excited at this wavelength. Figure 3: Excitation and emission spectra for APC and APC-Cy7...reporter, such as GFP or mCherry, through genetic modification. As your protein of interest will only occur...excitation and emission. The visible color spectrum is located in a range of wavelengths of about 380–700 nm. ...

  16. Plasmids 101: NGS Quality Control for Pooled Libraries

    Type
    Blog Post
    ...curves from our recent amplification of the Brunello library are also shown in Figure 3. I hope you’ll agree...would be a good time to talk about the amplification and verification processes we use to ensure high-quality...your own experiments. Library amplification 101 Library amplification seems straightforward: E. coli ...transformed with the library DNA, they grow and replicate, and then their DNA is harvested, much like one...library has its own depositor transformation and amplification protocol, but the overall workflow is similar...ll need to remember when undertaking library amplification and sequencing. Maintain representation of the...electrocompetent Stbl4 cells when performing amplifications, and we use electroporation to ensure a good...

  17. Another Pathway into Cells: iTOP

    Type
    Blog Post
    ...Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi:10.1016/j.cell.2015.03.028. PubMed. ...protein-only transduction method and its potential applications to CRISPR/Cas9 genome editing.   Protein-only...the HIV protein Tat. Although CPP fusions can translocate a cell membrane, the presence of the CPP may ...that components in the buffer used for protein purification must be helping the untagged protein enter cells...Diego D'Astolfo. CRISPR/Cas9: a potential application of iTOP Having tested iTOP using Cre-lox recombination...showed up to 70% resistance to diphtheria toxin, indicating a 70% frequency of biallelic mutations. Importantly...Importantly, hESCs retained their stemness, indicating that iTOP may be valuable for CRISPR/Cas9 stem cell...

  18. Hot Plasmids - June 2020 - Barcoded CRISPR Library, Sparse Cell Labeling, Calcineurin Reporter, and DNA Staining Dye Alternative

    Type
    Blog Post
    ...stressed or aging cell populations. Figure 3: Micrographs of wild type (top panels) and cells with...infection, because this setup allows for experimental replicates for each of the gRNAs. The idea was to assign...cassette is removed, the effector is expressed. By truncating one of the recombination sites in the construct...intermediate (d), and sparse (e) labeling of the calcium indicator, GCaMP6f, in the Drosophila optic lobe. Image ... reporter (blue) and stained with PI (pink) to indicate cell death. Image from Diessl et al., 2020. ...https://dx.doi.org/10.15698%2Fmic2020.04.713 Truncated TALE-fluorescent protein fusions as a DNA staining...protein to the DNA. They created plasmids for purification of tTALE-eGFP and tTALE-mCherry. In comparison...

  19. What Do I Do Now? Academic v. Non-Academic Career Decisions

    Type
    Blog Post
    ...need to move around every 3-6 years—a short and exciting ride Complicated matrix structures are common...scientific and technical training is that these educational paths prepare you for a vast selection of career...tech transfer, management consulting, science communication, policy and the diverse options in nonprofit...science is much like industry but the “product” is publications—the pressure to produce is the same You get ...and teach students Collaborations may be less “complicated” - for example, easy to initiate a collaboration...is different about non-academia? Scientific publications are a nice to have, not a need to have Must ...

  20. Revamp Your Lab Meetings With Creative Virtual Collaboration

    Type
    Blog Post
    ... for a Successful Collaboration. PLoS Comput Biol 3:e44 . https://doi.org/10.1371/journal.pcbi.0030044...Collaboration and creativity are pivotal in writing publications/grants too. As described by several works (Wuchty...backgrounds.” This work outlines the need for clear communication, fair credit through authorship, and acceptance...remotely. The authors stress the fact that “miscommunication, a lack of leadership, and inappropriate tools...approaches can lead to frustration, delay of publication, or even the termination of a project.” Take ...setting. Check out the blog post “Fostering Communication in Remote Collaborations” to get more ideas....Lewis ASL, Weyhenmeyer GA, O’Reilly CM, Lofton ME, Catalán N (2018) Ten simple rules for collaboratively writing...
Showing: 361 - 380 of 563 results