We narrowed to 633 results for: gats

...Drugs, DREADDs) and optogenetics as tools to investigate the roles of certain cell types in locomotion...cause the least amount of immune response. Any investigator who is using an in vivo animal model should ...

... developing recombinant antibodies, antibody conjugation, chimeric antibodies, and smaller engineered ...engineered antibodies, including chimerization, conjugation, and antibody fragments. Fab: fragment antigen...

...establish your own lab and get an independent investigator grant (e.g. an R01 from the NIH, in the United...can be found during conversations with senior investigators. Discussions can reveal mutual scientific interests...

...antibody.Note: Always include a positive and a negative control for the tagging experiment and test them...PubMed Central PMCID: PMC5312033. 2. Dewari PS, Southgate B, Mccarten K, Monogarov G, O'Duibhir E, Quinn...

...targeting each of the 1000 genes you’d like to investigate in your next CRISPR screen. Luckily, the Green... unbiased discovery. With these screens, the investigator generates a cell population where all genes ...

...at crossing the cell membrane. So, you should investigate your options and weigh the potential benefits...). In vivo protein labeling with trimethoprim conjugates: A flexible chemical tag. Nature Methods, 2(4...

... create a thin sheet of excitation light that propagates perpendicular to an imaging objective that collects...excitation light is completely reflected, energy is propagated into the sample via an evanescent wave that only...

...sites until after RNA loading: the structure to interrogate the sequence isn’t in place yet.     ... Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. ...

... intermediate pluripotent state is not always obligatory in cell conversion processes [35]. Rather than... during the reprogramming process as they are propagated in vitro as part of the process. This opens up...

...fine; a 5% positive error on one side and a 5% negative error on the other will introduce unwanted variation...adapted from Wong, 2018.    🔥Hot Tip🔥 Negative fold changes in ΔΔCT are represented by RQs between...

...digest should discriminate between positive and negative clones. Clones with insertion will show only linearized...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ...

...new and updated content in a clean and easy-to-navigate design. You can find it, along with other eBooks...

... scientists to use it as a model organism to interrogate many scientific questions. But these tiny creatures...

...collaboration with Addgene writers High Complexity Golden Gate Assembly with NEB's DADExperts: Matthew Norton and...

...publishing research. Addgene’s research team also investigates new strategies to improve viral vector production...

...cytometry expertise in three posts. An Introduction to Gating in Flow Cytometry, Designing Your First Flow Panel...

...! AAV purification by iodixanol gradient ultracentrifugation This video goes over AAV vector purification...

...series.   And if you haven’t seen our webinar “Navigating an Expanding Landscape for Engineered Systemic...

...start the AAV packaged on request process, simply navigate to your plasmid of interest. If it’s eligible ...

...years, in vivo CRISPR screens have been used to interrogate T cells, an important immune cell type, in more...