Skip to main content

We narrowed to 635 results for: gats

Showing: 361 - 380 of 635 results
  1. A Guide to Getting Started in Undergrad Research

    Type
    Blog Post
    ...postdoc” is, and that “PI” stood for principal investigator. In basic science (as opposed to translational...in a lab. Position Common tasks Principle investigator (PI) Runs the lab Writes a lot of grants Varying...
  2. 9 tips for a successful postdoctoral experience

    Type
    Blog Post
    ...establish your own lab and get an independent investigator grant (e.g. an R01 from the NIH, in the United...can be found during conversations with senior investigators. Discussions can reveal mutual scientific interests...
  3. Transferable Skills Guide: Teamwork

    Type
    Blog Post
    ...talent, of human knowledge, that has ever been gathered at the White House - with the possible exception...someone to coordinate, someone to decide, someone to delegate, etc. If you find that there is not someone (or...
  4. Important Considerations When Using AAVs

    Type
    Blog Post
    ...Drugs, DREADDs) and optogenetics as tools to investigate the roles of certain cell types in locomotion...cause the least amount of immune response. Any investigator who is using an in vivo animal model should ...
  5. Live and Let Dye: Self-Labeling Protein Tags

    Type
    Blog Post
    ...at crossing the cell membrane. So, you should investigate your options and weigh the potential benefits...). In vivo protein labeling with trimethoprim conjugates: A flexible chemical tag. Nature Methods, 2(4...
  6. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ... create a thin sheet of excitation light that propagates perpendicular to an imaging objective that collects...excitation light is completely reflected, energy is propagated into the sample via an evanescent wave that only...
  7. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ...targeting each of the 1000 genes you’d like to investigate in your next CRISPR screen. Luckily, the Green... unbiased discovery. With these screens, the investigator generates a cell population where all genes ...
  8. A Needle in a Base-Stack: Cas9 Structural Biology

    Type
    Blog Post
    ...sites until after RNA loading: the structure to interrogate the sequence isn’t in place yet.     ... Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. ...
  9. Deep Dive: qPCR

    Type
    Blog Post
    ...fine; a 5% positive error on one side and a 5% negative error on the other will introduce unwanted variation...adapted from Wong, 2018.    🔥Hot Tip🔥 Negative fold changes in ΔΔCT are represented by RQs between...
  10. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...digest should discriminate between positive and negative clones. Clones with insertion will show only linearized...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ...
  11. We’re Going Viral This Week!

    Type
    Blog Post
    ...publishing research. Addgene’s research team also investigates new strategies to improve viral vector production...
  12. Summer Fun at Addgene!

    Type
    Blog Post
    ...series.   And if you haven’t seen our webinar “Navigating an Expanding Landscape for Engineered Systemic...
  13. AAV Packaged on Request is Here!

    Type
    Blog Post
    ...start the AAV packaged on request process, simply navigate to your plasmid of interest. If it’s eligible ...
Showing: 361 - 380 of 635 results