Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 144 results for: MYC;

Showing: 31 - 60 of 144 results

  1. Sequencing Primers

    Type
    Guide
    ... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...

  3. Tetracycline Inducible Expression

    Type
    Collection
    ...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...blasticidin selection. See Plasmid #26730 for hygromycin selection. rtTA3 Eric Campeau 128061 pLVX-Tet3G...

  4. Zebrafish Plasmid Collection

    Type
    Collection
    ...either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 ...

  6. Cre-lox system

    Type
    Collection
    ...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion...Capecchi 116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre...

  7. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...fragment with FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting in a rapamycin-inducible Cas9...Addgene: Rapamycin-inducible Cas9 sets (Addgene plasmids 62883 &62884; 62885 & 62886) Rapamycin-inducible...separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...Cas9 for genome editing. Without rapamycin treatment, the Cas9(N)-FRB-NES fragment is actively shuttled...to the nuclear export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS...

  8. Bacterial Expression Systems

    Type
    Collection
    ... include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Sabine...Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Vinay...Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84692 pMyC-kan Acetamidase promoter... PnitA-NitR ε-caprolactam Escherichia coli , Streptomyces sp. Xuming Mao 46888 pMSP3545 PnisA Nisin Escherichia...promoter Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84689 pMyBADC-kan pBAD Arabinose...Arabinose Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 17806 pPro18 pPrpB Propionate Escherichia...

  9. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...Library 159391 Knockout Mouse Moffat 3rd 4 182 Mycobacterium tuberculosis CRISPRi Library (RLC12) 163954 ...Inhibition M. tuberculosis Rock NA Varies 96,700 Mycobacterium smegmatis CRISPRi Library (RLC11) 163955 Inhibition...

  10. Molecular Biology Reference

    Type
    Guide
    ...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...EtOH) 25 µg/mL Hygromycin B 200 mg/mL 200 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...

  11. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...deposited HA tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al...pharmaceutical industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production...designed to complement unused auxotrophies in Saccharomyces strains by compensating for histidine (HIS3)...

  12. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type
    Blog Post
    ...Slow transformation   Spectinomycin/streptomycin Spectinomycin and streptomycin both inhibit protein synthesis.... Pros: Stable (spectinomycin). Cons: Cost (spectinomycin) or stability (streptomycin), doesn’t work for... for transformations. Con: Expensive.   Kanamycin Kanamycin, or kan, is an aminoglycoside which inhibits...Like carb, spectinomycin is the more stable and expensive antibiotic compared to streptomycin. Spectinomycin...Spectinomycin/streptomycin can be successfully used for plant and bacterial culture, but some types of bacteria...bacteria.   Zeocin  Zeocin is a member of the bleomycin family of antibiotics, which induce cell death...decorative" title="Check icon" %} Satellite colonies Kanamycin Excellent No Bacteria and eukaryotes (G418) {%...

  13. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ...shorter plasmid curing time. pCRISPomyces for editing in Streptomyces  Streptomyces bacteria produce a wide...created two “pCRISPomyces” systems for use in Streptomyces (Cobb et al., 2015). pCRISPomyces-1 includes ...array, while pCRISPomyces-2 contains Cas9 and a gRNA cassette. The simpler system of pCRISPomyces-2 displays...for transcriptional silencing Mycobacterium tuberculosis and Mycobacterium smegmatis. In addition to their...carries a spacer targeting the gene of interest and kanamycin resistance E. coli carrying the phage recombineering...Gibson Assembly or restriction enzyme cloning. Streptomyces bacteria are more recombinogenic than E. coli...efficiencies or can be proteotoxic when used in Mycobacterial species, Sarah Fortune’s lab screened 11 other...

  14. Getting the Most from Your Lentiviral Transduction

    Type
    Blog Post
    ... labs and hinders experiments is mycoplasma contamination. Mycoplasma contamination has been shown to ...routinely test for mycoplasma contamination. There are several commercially available mycoplasma detection kits...larger microbes such as yeast, fungi, or bacteria, mycoplasma can be extremely hard to detect with levels reaching...cells per ml before the media becomes cloudy. Mycoplasma compete with host cells for nutrients and can...the cell line’s growth and behavior. Signs of a mycoplasma contamination can be subtle and may include reduced...positive controls. Routinely test your cell line for mycoplasma and discard it if the culture has become overly...References 1. Hay, R.J., Macy, M.L. & Chen, T.R. “Mycoplasma infection of cultured cells.” Nature 339 (1989...

  15. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...subunit S12 of 30S ribosome Confers resistance to streptomycin Tn10   Confers resistance to tetracycline ...galK rpsL (StrR) endA1 nupG fhuA::IS2 DB3.1 Streptomycin  HB101 derivative. For propagating plasmids ...lacY1 proA2 rpsL20(Smr) xyl5 Δleu mtl1 DH10B Streptomycin MC1061 derivative. General cloning and storage...lacZYA-argF)U169, hsdR17(rK- mK+), λ– HB101 Streptomycin Hybrid of E. coli K12 and E. coli B (mostly ...proAB+ lacIq lacZΔM15] hsdR17(rK-mK+) JM110  Streptomycin  For storing plasmids that should not be Dam...proAB+ lacIq lacZΔM15] hsdR17(rK-mK+)  MC1061 Streptomycin Parent of DH10B/TOP10 and derived strains, common...lac-proAB) mcrA Δ(mcrBC-hsdRMS-mrr) λ-  Stbl3  Streptomycin Derived from HB101. For cloning into and storage...

  16. Pathways Over Time Plasmids Engage Students in Functional Genomics Research

    Type
    Blog Post
    ...methionine synthesis (5). The budding yeast, Saccharomyces. cerevisiae, makes a great reference organism... or not proteins from the fission yeast, Schizosaccharomyces pombe, have the same function as their counterparts...yeast for budding geneticists: A primer on the Saccharomyces cerevisiae model system. Genetics 197, 33-48...yeast for young geneticists: A primer on the Schizosaccharomyces pombe model system. Genetics 201, 402-423...Surdin-Kerjan, Y. Metabolism of sulfur amino acids in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 61, 503-532.... et al. Functional characterization of the Saccharomyces cerevisiae genome by gene deletion and parallel...

  17. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ...where recombination has occurred. Neomycin, puromycin, and hygromycin resistance genes are commonly used...insert a resistance gene. The vector contains a neomycin resistance gene (NeoR) flanked by homology arms...remove a resistance gene. In this construct, the neomycin resistance gene is floxed so that it can be removed...the sequence of GFP is cloned together with the Neomycin resistance (NeoR) gene between exon 1 and 3 of...

  18. Cre-ating New Methods for Site-specific Recombination in Drosophila

    Type
    Blog Post
    ...from Kluyveromyces drosophilarum), R (from Zygosaccharomyces rouxii), B2 (from Zygosaccharomyces bailii...as low toxicity. FLP/FRT recombinases (from Saccharomyces cerevisiae) had been used successfully in Drosophila...bailii) and B3 (from Zygosaccharomyces bisporus.) Reporter constructs equivalent to site-STOP-site-myrRFP...

  19. Plasmids 101: Antibiotic Resistance Genes

    Type
    Blog Post
    ... ug/mL Bleomycin glycopeptide Induces DNA breaks Bactericidal 5-100 ug/mL Erythromycin macrolide...Class Mode of Action*   Working Concentration** Kanamycin aminoglycoside Binds 30S ribosomal subunit; ...mis-translation Bactericidal 50-100 ug/mL Spectinomycin aminoglycoside Binds 30S ribosomal subunit;...protein synthesis Bactericidal 7.5-50 ug/mL Streptomycin aminoglycoside Inhibits initiation of protein...

  20. Targeted Mutagenesis with EvolvR

    Type
    Blog Post
    ...result in a spectinomycin resistant phenotype in bacteria. While there are many known spectinomycin resistance...generate bacteria resistant to both spectinomycin and streptomycin, but could also be used for studying...five dispersed regions of the target gene of spectinomycin, rpsE. These results not only uncovered novel...

  21. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ... gentamicin, hygromycin, kanamycin, nourseothricin (clonNat), spectinomycin, streptomycin, tetracycline...maintain a glycerol stock. Choose from: ampicillin, apramycin, blasticidin, bleocin (zeocin), chloramphenicol...

  22. Viral Production at Addgene

    Type
    Blog Post
    ..., and is routinely tested for mycoplasma contamination using mycoplasma detection kits. Cell line is maintained... tested for mycoplasma contamination. To date, Addgene has never had a case of mycoplasma contamination...normalization purposes are being used. Quality Control Mycoplasma Our 293T cell line was obtained directly from...

  23. Your Top Requested Plasmid in 2016!

    Type
    Blog Post
    ...SpCas9 is fused to the puromycin resistance gene through a 2A peptide. The puromycin resistance gene enables...causes the ribosome to translate Cas9-2A and the Puromycin resistance gene as separate peptides. PX459 This...predecessor, which had a point mutation in the puromycin resistance gene that made it less effective in...

  24. Plasmids 101: Mammalian Vectors

    Type
    Blog Post
    ...80S; inhibits chain elongation 100-800 ug/mL Hygromycin B hygB HeLa, NIH3T3, CHO, Jurkat T cells Blocks...80S; inhibits chain elongation. 50-500 ug/mL Puromycin pac HeLa, 293HEK, Jurkat T cells Inhibits protein...do not confuse this with G418 (aka Geneticin). Neomycin should not be used for mammalian expression – ...confers G418 resistance; however, like gentamicin, neomycin is typically used to suppress bacterial growth...

  25. Plasmids 101: Shuttle Vectors

    Type
    Blog Post
    ...shared by bacteria and eukaryotes. For example, puromycin inhibits protein synthesis across kingdoms by ...targeting a shared aspect of ribosomal function. A puromycin resistance gene on your vector can protect both...antibiotics also block protein synthesis, and the neomycin resistance gene protects against any of them. ...aminoglycosides work on different host species: kanamycin targets the prokaryotic ribosome, while G418 (...

  26. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...10.1093/genetics/iyae126.   Gene disruption in Mycobacterium abscessus using a dual-plasmid CRISPR/Cas9 system...dual-plasmid CRISPR/Cas9 system for gene disruption in Mycobacterium abscessus, an increasingly common human pathogen...-based systems have been developed for other mycobacteria, but such systems don’t always work across species...for rapid and efficient genetic disruption in Mycobacterium abscessus. J Bacteriol., 206(3), e0033523. https...

  27. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...Gluconacetobacter xylinus, Haemophilus influenzae, Hypomycrobium X, Legionella pneumophila, Methylophilus methyltrophus...calcoaceticus, Actinobacillus pleuropneumoniae, Actinomyces naeslundii, A. viscosus, Aerobacter aerogenes...Methylophilus methylotrophus, Moraxella spp., Mycobacterium aurum, M. smegmatis, Paracoccus denitrificans...spheroides, Salmonella spp., Serratia marcescens, Streptomyces lividans, Synechococcus spp., Thiobacillus ferrooxidans...

  30. Addgene-Seeding Labs plasmid grant round 3: microbial drug resistance and biofilms, antidiabetic plant components, visualizing brain injury - and a glowing robot fish

    Type
    Blog Post
    ...Understanding drug resistance mechanisms of Mycobacterium tuberculosis Dr. Patricia Sheen, Universidad...interested in understanding the mechanisms behind Mycobacterium tuberculosis resistance to pyrazinamide (PZA...methods and improved therapies for PZA-resistant Mycobacteria tuberculosis. Investigation of multispecies ...
Showing: 31 - 60 of 144 results