Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 910 results for: ire;

Showing: 31 - 60 of 910 results

  2. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro:...pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro) are also in the...M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 ORF3a Lentiviral... See our Serotype Testing AAV inventory for the entire collection! Plasmid Serotype Name Depositor ...

  3. Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools

    Type
    Blog Post
    ... Communications. 2017. PubMed PMID: 28924139. FIRE-Cas9 for inducible interrogation of the epigenome...Article contributed by Joanne Kamens Listen to the Fire-Cas9 Podcast Segment Jerry Crabtree’s lab has developed...Inducible Recruitment for Epigenome editing by Cas9 (FIRE–Cas9), combines these approaches to enable rapid...cell type. By varying which sgRNAs are used with FIRE-Cas9, experiments can be designed to target multiple...analysis of epigenetic memory at nearly any locus. The FIRE-Cas9 plasmids can be found here. Braun et al. Nat...controls expression of transcription factor 2, which directly controls expression of a reporter protein, it ...

  4. New and Upcoming Viral Vectors - June 2019

    Type
    Blog Post
    ...)-mCherry 50467  AAV2 pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine 121538  AAV5 pOTTC1484 - pAAV SYN1 HA-hM4D...Serotype Name 119741  AAV5  AAV SYN flex PSAM4 GlyR IRES EGFP Recombinase AAV Finally, we are excited ...Plasmid Serotype Name 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Chemogenetics... Serotype Name 119472  AAV5  AV SYN PSAM4 GlyR IRES EGFP   Biosensors Plasmid Serotype Name ...in the last few months. You can also browse our entire AAV inventory. Our new AAVs include: Control AAVs...

  5. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...GlyR IRES EGFP Chimeric channels for neuronal manipulation 119742  AAV5  AAV SYN PSAM4 GlyR IRES EGFP...-dependent CRE) 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Calcium sensors...released so far in 2019. You can also browse our entire AAV inventory! Our new AAVs include: pGP-AAV-syn-FLEX-jGCaMP7b-WPRE...neurotransmitter in vertebrates, but methods for directly imaging GABA have been limited. Like calcium sensors...

  6. RaPID Detection of RNA-protein Interactions

    Type
    Blog Post
    ...Element (IRE) RNA motif of the ferritin light chain RNA transcript. IRE motifs are bound by IRE binding...cannot distinguish between proteins that directly or indirectly interact with the bait. Also, RaPID can...binding proteins, IREB1 and IREB2, which post-transcriptionally regulate iron metabolism pathway transcripts...interactions or to analyze chromatin states (CHIP-seq, FAIRE-seq, Cut & Run) and to detect protein-protein interactions...RNA-protein interactions due to sample processing. Require prior knowledge that the protein of interest interacts... methods are not ideal for in vivo work. BirA* requires 16-18 hours to sufficiently biotinylate interacting...found that all HHCS-associated sequences had lower IREB2 binding enrichment compared to wild-type sequences...

  7. Viral Production at Addgene

    Type
    Blog Post
    ...cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes (...expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth (Addgene viral... Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the absence...Control Mycoplasma Our 293T cell line was obtained directly from Takara, and is routinely tested for mycoplasma...

  8. New Viral Vectors - March 2024

    Type
    Blog Post
    ...Biosensor Looger New serotype pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST AAV9 Optogenetics Adesnik New viral vector...

  9. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...doi.org/10.1128/jvi.71.8.6174-6178.1997 Wickersham IR, Finke S, Conzelmann K-K, Callaway EM (2006) Retrograde...–49 . https://doi.org/10.1038/nmeth999 Wickersham IR, Lyon DC, Barnard RJO, Mori T, Finke S, Conzelmann...Infection of these cells with VSV-G pseudotyped virus requires the upregulation of LDLR expression using other...neurons. However, VSV-G’s broad tropism can be undesired for in vivo studies since there’s the potential...neuronal cells and can travel in a retrograde direction from the synapse to the cell body, making it a...use rabies virus is to delete the glycoprotein required for entry into the cell (rabies dG). Because rabies... system (Wickersham et al., 2007). This system requires first supplying rabies glycoprotein along with...

  10. Sequencing Primers

    Type
    Guide
    ...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...

  11. CRISPR Guide

    Type
    Collection
    ...combination of wild type alleles, NHEJ-repaired alleles, and the desired HDR-edited allele. Therefore, it is...presence of the desired edit experimentally and to isolate clones containing the desired edit (see: Validate...) and the desired edits on a RT template. The PBS base pairs to the 3’ flap, and the desired edit is incorporated...transcription-activator-like effector nucleases (TALENs) required scientists to design and generate a new nuclease...the Cas enzyme. Basic Mechanisms of CRISPR The requirements for a CRISPR knockout assay are simple. You’...continue to anneal to the target DNA in a 3′ to 5′ direction. The location of any potential mismatches matters...of the PAM sequence. The resulting DSB is then repaired by one of two general repair pathways: the efficient...

  12. Plasmids for Stem Cell Research

    Type
    Collection
    ...and study of stem cells, from iPSC generation to directed differentiation....the body and have the capacity to give rise to an entire organism. iPSC technology removes the possible ...below. Once iPSCs have been created they can be directly differentiated into specific somatic stem cells...Plasmids below. Alternatively, it is also possible to directly differentiate one differentiated somatic cell ...endogenously-tagged gene variants or browse Addgene’s entire collection of Stem Cell Research Plasmids . For...lentiviral plasmids A drug-inducible system for direct reprogramming of human somatic cells to pluripotency...Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic ...

  13. Antibody Guide

    Type
    Collection
    ...antibodies? Will you be using a direct or indirect detection method? If indirect, do you already have secondary...signal amplification through the indirect detection method. In the direct detection method, the signaling...most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein of...antibody methods, it can be done using either an indirect or direct method. Since IF uses fluorophore color to...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...complex. Due to their increased manufacturing requirements, monoclonal antibodies are typically more expensive... Polyclonal antibodies are typically collected directly from animals and contain antibodies targeting ...

  14. Plan Your Experiment

    Type
    Collection
    ...experiment. Select Your Desired Genetic Manipulation Different genetic manipulations require different CRISPR...will not contain the desired edit, as a large percentage of DSBs are still repaired by NHEJ. How do you...contain your desired edit, including but not limited to: Mismatch-cleavage assay (for NHEJ repaired DSBs): ...targeting the region where the edit should be made HDR requires a repair template and displays reduced efficiency... sequence be very close to the location of the desired edit, ideally less than 10 bp away. In this case...PAM sequences for your chosen enzyme within your desired sequence, you may want to consider alternative ...consider factors that maximize cleavage of the desired target sequence or on-target activity . Two gRNA...

  15. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...technique creates diverse populations of mutants for directed evolution. ID Plasmid Gene/Insert Promoter Selectable...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...

  16. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  17. Brain Armamentarium

    Type
    Collection
    ...Alias: CN4361) Expression of jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4360) Expression of jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...: CN4035) Expression of CoChR-EGFP in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...Alias: CN3987) Expression of jRGECO1a in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...AAV for Cre recombinase expression in striatal indirect pathway D2-MSNs Jonathan Ting Viviana Gradinaru... AAV for Cre recombinase expression in striatal direct pathway D1-MSNs Jonathan Ting Viviana Gradinaru...

  18. Genetic Code Expansion

    Type
    Collection
    ... 105829 pIRE4-Azi Azi-tRNA synthetase (EAziRS) p-Azido-phenylalanine (Azi) Mammalian TAG Irene Coin 105830...biologists have expanded the genetic code by redirecting specific codons to encode amino acids beyond ...E.coli and can be mutated and screened through directed evolution to charge the tRNA with a different ...-like click amino acids, tRNA M15 Mammalian TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M....182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA.... Expresses yeast TrpRS/tRNA pair instead. For directed evolution of the liberated EcTrpRS/tRNA pair to...

  19. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...be separated by an internal ribosome entry site (IRES) and expressed under the same promoter. Alternatively...cells - one containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA...response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid), 2) the HIV-1 genome...in terms of RCL generation because this vector requires only three HIV-1 genes (gag, pol, and rev) for...that there is often  background activity and it requires continuous administration of Dox to repress transgene...One drawback of the Tet system is that it often requires the delivery of two distinct expression vectors...This supernatant can be stored at 4 °C or can be directly added to your target cells. However in that case...

  20. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...contains a special Protospacer Adjacent Motif (PAM) directly after where the crRNA would bind. (5) After the...double-strand break (DSB) induced by Cas9 could be repaired through non-homologous end joining (NHEJ) , an...homology arms was supplied, the break could be repaired according to this template, allowing for precise...tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety of ...occurred at a truly astonishing pace, with work directed towards increasing on-target editing rates and...cuts only one strand of DNA and can be used with paired gRNAs to lower off-target cleavage frequency. Truncated...rely on NHEJ or HDR: Base editors : Base editors directly convert bases without creating a double-strand...

  21. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  22. Validated gRNA Sequences

    Type
    Collection
    ...25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C....25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974...pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT 60212 cut S. pyogenes 25161212 Fire sv40 promoter...CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut ...GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 Fire rgs4 D. rerio GGAGAAGGTGAAGGACACTG 42246 cut S. ...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut...GGAACTCGTGTCAAAACAAC 59932 cut S. pyogenes 25161212 Fire unc-119 C. elegans GAATTTTCTGAAATTAAAGA 46169 cut...

  23. Viral Vectors

    Type
    Collection
    ...genome directs the production of more viruses. However, in theory, a viral genome could direct the host... of their mild immunogencity. These viruses can direct long-term transgene expression, but generally are...Adenoviruses have high transduction efficiency and direct high but transient transgene expression. γ-Retrovirus...molecules or to express other genes. Viruses used to direct these alternate functions simply have to harbor...array of viral genomes, enabling researchers to direct a wide array of genetic functions in cells. For... through the removal of certain genes that are required for viral replication. Thus, as a safety feature...occurring viruses do. Instead, the genes that are required for viral replication are usually divided among...

  24. CRISPR Plasmids - Plants

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  25. CRISPR Plasmids - Yeast

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Description Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9 to a specific locus, avoiding known transcription...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....

  26. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Monitoring the action of redox-directed cancer therapeutics using a human peroxiredoxin-2-based probe. Nat Commun... with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with peroxiredoxin-based...cellular locations. PLoS One. 2012;7(11):e49371. Direct comparison of a genetically encoded sensor and ...11/520/eaah3738. Justin Blau cAMP (cyclic AMP) cAMPFIRE cAMP biosensors with improved sensitivity Sensitive... PLoS One. 2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron...mitochondrial or cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors...mammalian expression (Constitutive or Cre-dependent) Directed Evolution of a Selective and Sensitive Serotonin...

  27. Worm Expression Resources

    Type
    Collection
    ...Wormbuilder website. General Tools Fire Lab C. elegans Vector Kit - Andrew Fire Lab. A set of vectors for C....characterized which allow researchers to express desired constructs in precise cell types and/or developmental...plasmids that can be used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert ...modified approach has also been developed by the Fire laboratory and described in Efficient Marker-Free...vectors. C. elegans optimized fluorophores - Andrew Fire Lab. Available with and without PATC, which diminishes...

  28. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...off-target alterations and require only a single gRNA. Cas3 must be paired with the Cascade ( C RISPR-...can continue for many kilobases in one or both directions from the target region, effectively turning Cas3... Cas5, Cas6, Cas7, Cas8, and Cas11. Cascade is directed to target DNA using a gRNA and recruits Cas3. ...other proteins bound to DNA, and the break can be repaired by the cell’s endogenous repair mechanisms. Cas3...

  29. Bacterial Expression Systems

    Type
    Collection
    ...bacterial genome itself. Manipulating the genome directly can give you more subtle control over protein ...thereby limiting the use of cellular resources required for the production of large amounts of protein...studying the basic biology of a bacterial gene or redirecting metabolic pathways to produce a therapeutic compound...Transposition is efficient enough that selection is not required. pET-HIS-Sangamo 40786 TALEN Gang Bao Gateway ...expression of a recombinant protein with a 6x His tag. Requires a strain with T7 RNA polymerase. Amp resistant...expression from that element. When this activation requires a transcription factor to bind to a small molecule...

  30. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mT-sapphire 399 511 Monomer (A206K) mT-Sapphire-N1 - Mammalian Expression mT-Sapphire-C1 - Mammalian...Structure Plasmids T-sapphire 399 511 26 4.9 1.3 hr Prone to dimerization pFA6a-link-yETSapphire-CaUra3 - Yeast...Mammalian Expression mT-Sapphire-pBAD - Bacterial Expression mAmetrine 406 526 26 6 0.8 hr Monomer (A206K...
Showing: 31 - 60 of 910 results