We narrowed to 73 results for: 4-Oct
-
TypeBlog Post...Nature Biotechnology, 41(4), 500–512. https://doi.org/10.1038/s41587-022-01527-4 Additional resources on... 149–157. https://doi.org/10.1038/s41586-019-1711-4 Chen, P. J., Hussmann, J. A., Yan, J., Knipping, F...post was originally written by Jennifer Tsang in October 2019 and updated by Emily P. Bentley in December...
-
X-CHIME: Context Dependent Germline Knockout in Immune Cells
TypeBlog Post...1335–1347. https://doi.org/10.1038/s41590-019-0480-4 LaFleur, M. W., Nguyen, T. H., Coxe, M. A., Yates,... X-CHIME plasmids here! Marty LaFleur is a Postdoctoral Fellow in Arlene Sharpe’s laboratory at Harvard... -
Screening for Successful Genome Editing with Digital PCR
TypeBlog Post...Protoc 11, 598–615 (2016). PubMed PMID: 26914317. 4. Mock, U. et al. mRNA transfection of a novel TAL ...This post was contributed by Scott Findlay, a Postdoctoral Fellow at the University of Alberta. If you’... out of frame! Scott Findlay is currently a Postdoctoral Fellow at the University of Alberta. He is interested... -
dTAG - You're it!
TypeBlog Post...degradation of endogenous proteins (notably, BRD2/3/4, CDK9, TRIM24, FLT3, BTK, and ALK) by linking small...contributed by guest blogger Behnam Nabet, a postdoctoral fellow at Dana-Farber Cancer Institute. Targeted...studies (Nabet et al.). Behnam Nabet, PhD is a postdoctoral fellow at the Dana-Farber Cancer Institute. ... -
Crowdfight, a Platform to Boost Scientific Collaboration During COVID-19 and Beyond
TypeBlog Post...direct collaboration between researcher and expert; 4) Credit all contributions. Our volunteers are...IgnacioAmigoH María Hernández-Sánchez is a postdoctoral researcher at Instituto de Investigación Biomédica... -
Four Factors that Differentiate the Stem Cell Field
TypeBlog Post...Something in their world should be fast and affordable. 4. Stem cell scientists are generous Besides some of...differentiated cells simply by expressing four proteins Oct4, Sox2, Klf4, and cMyc (the so called OSKM factors... -
5 Great Apps for Lab Life
TypeBlog Post...restriction enzyme sequence resource is universally useful. 4. Chemical Safety Data Sheets by ThatsMyStapler Safety...Management Software Resources on Addgene.org Find Protoctols for Your Research Catch Up On Your Molecular ... -
7 Tips to Secure a STEAM Internship This Summer
TypeBlog Post...that can help you craft a solid personal statement. 4. Letters of recommendation wisdom Reach out to 2-...Pierre! Roodolph (Roo) P. St Pierre is currently a doctoral candidate in the Chemical Biology Program at Harvard... -
Tips for Getting a Faculty Position
TypeBlog Post...Joanne Kamens's "10 Steps to a Perfect Science Talk." 4. The chalk talk, simple in principle The first question... potential collaborations, critiques of your postdoctoral research, etc. The second question is whether...from Oregon Health Sciences University, did his postdoctoral fellowship with Jennifer Lippincott-Schwartz...and now serves as the Director of Student and Postdoctoral Programs at the Janelia Research Campus of the... -
Validated gRNA Sequences
TypeCollection...pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere... interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S...CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N.... -
Viral Vectors 101: An Introduction to AAV
TypeBlog Post...receptor for adeno-associated virus infection."Nature 4:520(7588):108-12 (2016). PubMed PMID: 26814968. McCarty...Guerin and Susanna Stroik. Didem Goz Ayturk is a Postdoctoral Fellow in Connie Cepko’s Lab investigating neuronal... -
Deep Dive: qPCR
TypeBlog Post...real-time PCR experiments. Clin Chem. 2009 Apr;55(4):611-22. doi: 10.1373/clinchem.2008.112797. Epub 2009...GAPDH. Biochem Biophys Res Commun. 2001 Mar 9;281(4):951-6. doi: 10.1006/bbrc.2001.4439. PMID: 11237753...Nucleic Acids Research, Volume 28, Issue 19, 1 October 2000, Pages 3752–3761, https://doi.org/10.1093/... -
Plasmids 101: The Wide World of Natural Plasmids
TypeBlog Post...Biotechnology. Critical Reviews in Biotechnology, 24(4), 155–208. https://doi.org/10.1080/07388550490904288...January 2017 and was updated by Emily P. Bentley in October 2024. References and Resources References Demanèche... -
Savvy Advocates Needed to Navigate a Scientific Enterprise in Flux
TypeBlog Post...PMID: 25653845. Pubmed Central PMCID: PMC4304227. 4. Revitalizing biomedical research: recommendations...working group (National Academy of Sciences. “The Postdoctoral Experience Revisited” 2014 Appendix B p93-95... -
Adapting Toehold Switches to Detect Zika Virus
TypeBlog Post...PMID: 25417167. PubMed Central PMCID: PMC4243060. 4. Messina, Jane P., et al. "Mapping global environmental... switches for pathogen detection In 2014, as postdoctoral fellows with Jim Collins and Peng Yin at the... -
7 Simple Strategies to Resolve Conflicts with Difficult Supervisors
TypeBlog Post...side-tracked, and you might create even more conflicts. 4) Define in advance how you would like the problem ...the needs of other people. Some students and postdoctoral fellows are hesitant about expressing their ... -
AAVs in Retinal Gene Therapy
TypeBlog Post...Nature Genetics 28, 92-95. PubMed PMID: 11326284. 4. Bennett J, 2017. Taking Stock of Retinal Gene Therapy...amaurosis. This is the first of what I, scientists, doctors and patients hope are many more clinical successes... -
Better Dyeing Through Chemistry & Small Molecule Fluorophores
TypeBlog Post...PMID: 18355003. PubMed Central PMCID: PMC2802578. 4. Xue, Lin, et al. "Imaging and manipulating proteins... tag (Figure 1c). Click chemistry (e.g., transcyclooctene–tetrazine)– Nonnatural amino acids can be ... -
Healthcare Consulting: A Door to the Business of Life Sciences
TypeBlog Post...that they will switch to other newer topics every 4-8 weeks. These topics are typically cutting edge; ...given therapeutic approach brings to patients, doctors, and insurance providers, and is crucial to how... -
March for Science
TypeBlog Post...enables science: “humility in the face of evidence” (4). Frustration among scientists has been rising as ...active research scientists (scientists who hold a doctorate degree, are currently working full-time, and have... -
AAV Production in HEK293 Cells
TypeProtocol...needed. Add stir bar and stir slowly at 4 °C for 1 h, then keep at 4 °C for 3 h without stirring to allow...Reagent Preparation DMEM Complete : 10% v/v FBS and 4 mM L-alanyl-L-glutamine (or stable alternative, such...glutaGRO 11 mL of 200 mM L-alanyl-L-glutamine. Store at 4 °C. D1 + 0.1 M sorbitol (optional) : DMEM low glucose... °C. After thawing, the solution can be stored at 4 °C for up to 2 months. After 2 months, discard the...solution may separate into phases. Aliquot and store at 4 °C. Cell Lysis Buffer : 50 mM Tris HCl, 150 mM NaCl... Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and ...Filter sterilize through a 0.22 μm membrane. Store at 4 °C. Considerations Before You Start The health of ... -
Antibody Validation Using the Indirect ELISA Method
TypeProtocol...for 2 h at room temperature or overnight at 4 °C . Section 4: Secondary antibody incubation Carefully remove... over several days by incubating certain steps at 4 °C instead of room temperature or 37 °C. The protocol...: Blocking Day 3: Primary antibody incubation Day 4: Secondary antibody incubation and plate read Tips...and incubate at 37 °C for 30 min , or overnight at 4 °C . Section 2: Block the plate Prepare the wash buffer...400 rpm for 2 h at room temperature or overnight at 4 °C . Section 3: Primary antibody incubation Carefully...400 rpm for 2 h at room temperature or overnight at 4 °C . Section 5: TMB reaction Carefully remove the ...micrograms of antigen loaded. Last reviewed on: October 8, 2024... -
15 Hot Plasmids from 2017
TypeBlog Post...through the expression of transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model...Addgene and include a variety of cMYC, KLF4, SOX2 and OCT4 DNA binding domain and transcription activation ...