Skip to main content
Addgene

We narrowed to 13 results for: 4-Oct

Showing: 1 - 13 of 13 results
  1. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Encoded Fluorescent Biosensor. Cell Metab. 2011 Oct 5;14(4):545-54. Gary Yellen NADH/NAD+ Peredox fluorescent...interneurons across vertebrate species. Nat Neurosci. 2016 Oct 31. Gordon Fishell Calcium GCaMP5 genetically encoded...indicator for neural activity imaging. J Neurosci. 2012 Oct 3;32(40):13819-40. Baljit Khakh , Douglas Kim , Loren...marking active neuron populations. Nat Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET... Secretion of Pancreatic Islets. Anal Chem. 2019 Oct 1;91(19):12212-12219. Huiwang Ai Zinc GZnP2 Cytosolic... for in vivo phosphate tracking. FEBS Lett. 2006 Oct 30. 580(25):5885-93. Wolf Frommer Pyruvate Pyronic...
  2. Neurodegeneration Research Collection

    Type
    Collection
    ...between Rab12 and LRRK2 . Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries...target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. Target neural oxytocin receptors using an AAV-CRISPR...dopaminergic activity in vivo. Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation... Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human mitochondrial DNA using mitoBEs ....transmission. Aggarwal et al. Nat Methods. 2023 May 4. See More iPSC Differentiation Factors Find plasmids...
  3. Plasmids for Stem Cell Research

    Type
    Collection
    ... pluripotent state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain...iPS cells; retroviral expression of human Sox2, Oct3/4, Klf4, and c-Myc from four separate plasmids Induction...transient expression of human L-Myc, Lin28, Sox2, Klf4, Oct3/4, Glis1, and EBNA1 from separate plasmids An Efficient...polycistronic expression of human Sox2, KLF4, L-Myc, Lin28, OCT3/4, and shRNA against p53 in different gene/insert...Fluorescent-tagged EBNA1-mediated expression of human Oct3/4, shp53, Klf4, Sox2, L-Myc, Lin28 from separate ...iPS cells; retroviral expression of mouse Sox2, Oct3/4, Klf4, and c-Myc from separate plasmids Induction...Apr 14;4(4):727-43. Woltjen Plasmid Mouse Non-integrating polycistronic expression of mouse Oct4, Klf4, ...
  4. p53 Pathway

    Type
    Collection
    ...p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097 . The expanding...Menendez D, Inga A, Resnick MA. Nat Rev Cancer. 2009 Oct;9(10):724-37. PubMed PMID: 19776742 . Germline TP53...cycle 25C Cdk4/6 CDK4 CDK6 Cyclin-dependent kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase...
  5. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Other citations include...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Rosario, et al. 2016. ... entry characteristics. Gene Ther . 2020 Apr;27(3-4):127-142. PMID: 31611639 AAV2(trpYF) When using the...
  6. Zhang Lab CRISPR Page

    Type
    Collection
    ....2013.08.021. Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using...2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. PubMed . Return to SpCas9 plasmids GeCKO Library...Jan;33(1):102-6. doi: 10.1038/nbt.3055. Epub 2014 Oct 19. PubMed . In vivo genome editing using Staphylococcus... Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014....Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. PubMed . Return to GeCKO...
  7. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Rafelski SM, Gunawardane RN. Mol Biol Cell. 2017 Oct 15;28(21):2854-2874. doi: 10.1091/mbc.E17-03-0209...Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin Microtubules 87422 LMNB1-mEGFP...
  8. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...Söll D, Isaacs FJ, Rinehart J. FEBS Lett . 2012. Oct 19;586(20):3716-22. PubMed (Link opens in a new window...iSPI_pSer_Subpool#3 Pooled Library 188529 iSPI_pSer_Subpool#4 Pooled Library 188530 iSPI_pSer_Subpool#5 Pooled Library...Rinehart J, Söll D. Science . 2011 Aug 26;333(6046):1151-4. PubMed (Link opens in a new window)...
  9. Immunology Research Plasmids and Resources

    Type
    Collection
    ...heavy diversity 4-23 (non-functional) IGHD423 IGHD4-4 immunoglobulin heavy diversity 4-4 DA4, IGHD44 IGHD5...heavy variable 4-30-2 IGHV4-3, IGHV4302 IGHV4-30-4 immunoglobulin heavy variable 4-30-4 IGHV4-3, IGHV4304...immunoglobulin heavy variable 4-39 IGHV439, VH IGHV4-4 immunoglobulin heavy variable 4-4 IGHV44, VH IGHV4-59 immunoglobulin...104A BD-4, DEFB-4, DEFB104, DEFB4, MGC118942, MGC118944, MGC118945, hBD-4 DEFB4 defensin, beta 4 DEFB-2...lambda variable 4-3 IGLV43, V5-1 IGLV4-60 immunoglobulin lambda variable 4-60 IGLV460, V5-4 IGLV4-69 immunoglobulin...hIL-3Ra IL4 interleukin 4 BCGF-1, BCGF1, BSF1, IL-4, MGC79402 IL4R interleukin 4 receptor CD124, IL4RA ...
  10. Genetic Code Expansion

    Type
    Collection
    ...Thomas Huber 207620 pRSF-G1(4/5FTrp)RS G1(4/5FTrp)RS Methanogenic archaeon 4-Fluoro-L-Tryptophan (4FTrp...jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram 182884 AzoRS-4 tyrosyl-tRNA...translation machinery. To expand the genetic code, 4 major changes to the standard translation machinery...acid would be incorporated. Other options, such a 4-base pair codons, have also been utilized. A tRNA ...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...pDule2-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...174718 pRSF-G1mCNPRS G1mCNPRS M. archaeon L-3-(2-cyano-4-pyridyl)alanine (mCNP) Bacterial TAG Thomas Huber ...
  11. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... pKa Maturation Structure Plasmids Sirius 355 424 4 3.0 Prone to dimerization Sirius-N1 - Mammalian Expression...mKate1.31-pBAD - Bacterial Expression mPlum 590 649 4 4.5 100 min Monomer pQC mPlum IX - Mammalian Expression...mRaspberry-N1 - Mammalian Expression TagRFP675 598 675 4 5 Prone to dimerization pTagRFP675-N1 - Mammalian ...His-miRFP670 - Bacterial Expression iRFP670 643 670 13 4 ~5 hr Dimer piRFP670-N1 - Mammalian Expression pBAD...HisB-iRFP702 - Bacterial Expression miRFP709 683 709 4 4.5 Monomer pmiRFP709-N1 - Mammalian Expression pBAD...HisD-LSSmKate1 - Bacterial Expression LSSmKate2 460 605 4 2.7 2.5 hr Monomer pLSSmKate2-N1 - Mammalian Expression...Shcherbo et al. : Nature Methods, September 2007, Vol. 4 No. 9, pp. 741-6 Shemiakina et al. : Nature Communications...
  12. Tetracycline Inducible Expression

    Type
    Collection
    ...effectors for Tet transregulators . BioTechniques, 37 (4), 546–550. https://doi.org/10.2144/04374BM04 (Link...TetO-FUW-OSKM Tet-On inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf...-tetO-hOKMS Tet-On inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei...
  13. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere... interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S...CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N....
Showing: 1 - 13 of 13 results