We narrowed to 59 results for: cag promoter

...shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR. Any expression cassette (promoter and gene of interest) can be cloned into the plasmid.... Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection. See Campeau et al. (2009...packaging construct encoding tat . Jakob Reiser 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur...

...iPSC-derived osteoblasts and osteoclasts together promote bone regeneration in 3D biomaterials. Sci Rep, ... damage results in the transdifferentiation of glucagon-producing α-cells into insulin-producing β-like-cells...

...commercially available. Table 4: Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted Expression Depending ...

...numerous high-frequency off-target sites in the HBG promoter that were missed by standard workflows, highlighting...off-targets remains challenging. Siyuan Zou (U. Chicago) presented Inrich-seq, a method that captures the...

.... Therefore, the same reaction which ligates a promoter into an empty backbone can be repeated to ligate...ligate your gene of interest after the promoter, and so on. The following table provides information for... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG...Enzymes: EcoR1 , NotI , Spel Suffix: GCTAGC GCGGCCG CTGCAG Suffix Enzymes: Nhel , NotI , PstI Scar: GCTAGT... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: ACTAGA..., (NgoMIV) Suffix: ACCGGT TAAT ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: Agel , Spel , Notl, Pstl Scar: ...

...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...check out our promoters reference page . Selectable Marker Used to select for cells that have successfully...

...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI...Addgene’s collection includes plasmids containing promoters that drive general and species-specific gene expression...constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal... (Link opens in a new window) — The initiative promotes interdisciplinary exchange, open technologies,...CRISPR. Successfully validated in tomato, tobacco, Medicago truncatula , wheat, and barley. Return to top ...

...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA...Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...Nopaline synthase promoter Forward Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter Forward OpIE2 Forward...

... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon receptor GGR, MGC138246 GDF1 growth...MGC70354, foveolin GLP1R glucagon-like peptide 1 receptor MGC138331 GLP2R glucagon-like peptide 2 receptor...