...Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru...pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE CAG Calcium sensor, Cre-dependent GCaMP Kim , GENIE 104496 pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE... PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent ...Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2...Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-...Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-...Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden Citation...

...Gradinaru 37825-CAP-B10 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...Gradinaru 37825-CAP-B22 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...Gradinaru 37825-CAP-MaCPNS1 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...Gradinaru 37825-CAP-MaCPNS2 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...

...fluorescent protein EYFP from the CAG promoter Viviana Gradinaru 104055-AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously...fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104055-AAVrg pAAV-CAG-eYFP An AAV genome that ...fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104055-PHPeB pAAV-CAG-eYFP An AAV genome that ...fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104061-PHPeB CAG-NLS-GFP AAV expression of nuclear...expression of dLight1.1 under CAG promoter Lin Tian 111067-AAV5 pAAV-CAG-dLight1.1 To generate Adeno-Associated...Li 158757-AAV8 pAAV-CAG-SomaGCaMP6f2 Cell body-targeted GCaMP6f, under CAG promoter: GCaMP6f followed by...Boyden 158757-AAV9 pAAV-CAG-SomaGCaMP6f2 Cell body-targeted GCaMP6f, under CAG promoter: GCaMP6f followed by...

...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ...Goldstein 48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP...pCAGGS-pac-T2A-iCre iCre CAG Mammalian Capecchi 116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc...Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre Cre CAG Mammalian...Heller 112619 pCAG-EHC Emerald, Cre-ERT2 CAG Mammalian Heller 112620 pCAG-mTHC TFP, Cre-ERT2 CAG Mammalian ... Cre CAG Mammalian Imai 125577 pCAG-iCre iCre CAG Mammalian Imai 125748 pCAG-sfGFP-GSAx9-iCre-ERT2 iCre-ERT2...HIV-TAT - promotes cellular uptake of recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian...

...104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Constitutive...general promoters. These AAV can be used to compare the activity of different serotypes. Promoter CAG CaMKIIa...pAAV-CAG-FLEX-EGFP CAG EGFP Cre dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Gradinaru...51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Zeng 59331 pAAV-CAG-FLEX-EGFP ...dependent (constitutive) expression 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 8, 9, rg*, PHPeB, CAP-B10...GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, ...tdTomato Flp dependent 1 Jensen 99133 pAAV-CAG-fDIO-mNeonGreen CAG mNeonGreen Flp dependent 1 Gradinaru INTRSECT...

...hM4Dnrxn (Gi) CAG mCherry No Sternson 52521 AAV-CAG::FLEX-rev:: ChR2HA-2a-hM4D hM4Dnrxn (Gi) CAG ChR2-2a Yes...Sternson 52520 CAG:: ChR2HA-2a-hM4D hM4Dnrxn (Gi) CAG ChR2-2a No Sternson 159457 AAVS1-pur-CAG-Bi-DREADD hM3D...PSAML141F,Y115F-GlyR CAG ChR2 2A Yes Sternson 32482 CAG::PSAMQ79G:GlyR-IRES-GFP PSAMQ79G-GlyR CAG IRES-EGFP No...hM4Dnrxn (Gi) CAG mCherry Yes Sternson 52525 CMV:: HA-hM4Dnrxn hM4Dnrxn (Gi) CMV No Sternson 52523 CAG:: mCherry... hM3D(Gq), KORD CAG mCherry No Chen 32483 rAAV-CAG::FLEX-rev:ChR2HA:2a:PSAML141F,Y115F:GlyR PSAML141F,...IRES-EGFP Yes Sternson 32480 CAG::PSAML141F,Y115F:GlyR-IRES-GFP PSAML141F,Y115F-GlyR CAG IRES-EGFP No Sternson...IRES-EGFP Yes Sternson 32478 CAG::PSAML141F:GlyR-IRES-GFP PSAML141F-GlyR CAG IRES-EGFP Yes Sternson 32477...

...Positive Control CAG promoter pEMS1293 cre CAG promoter pEMS1164 EGFP/cre CAG promoter pEMS1114 EGFP/cre...cre/NLS CAG promoter pEMS1157 EGFP/NLS CAG promoter pEMS1277 EGFP/NLS CAG promoter pEMS1294 intron-lacZ...Collections Pleiades Promoter Plasmids Pleiades Promoter Project The Pleiades Promoter Project was established...intron-lacZ/NLS CAG promoter pEMS1488 intron-lacZ/NLS Ple2 ADORA2A pEMS1142 EGFP/NLS Ple3 ADORA2A pEMS1143 EGFP...Plasmids from the Pleiades Promoter Project - A regulatory toolbox of MiniPromoters to drive selective expression...mouse brain through these human MiniPromoters. Browse the Pleiades Promoter Plasmids using the table below...Open Access Article . List of Pleiades MiniPromoters MiniPromoter Source Gene Construct Reporter Negative...

...Archon Voltron JEDI-2P 5-HT Sensors GRAB_5-HT Promoter CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory...dependent 1, 5, 9, rg* GENIE 162382 pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE CAG jGCaMP8f none Cre dependent 1, 5, 9, ...none Constitutive 1, 9 Looger 179254 AAV-CAG-jGCaMP8f-WPRE CAG jGCaMP8f none Constitutive 1, 9, rg* Looger...dependent 1, 9, rg* GENIE 162380 pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE CAG jGCaMP8s none Cre dependent 1, 9, rg*...none Constitutive 1, 9 Looger 179256 AAV-CAG-jGCaMP8s-WPRE CAG jGCaMP8s none Constitutive 1, 9, rg* Looger...dependent 1, 9, rg* GENIE 162381 pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE CAG jGCaMP8m none Cre-dependent 1, 9, rg*...Constitutive 1, 9, rg* Looger 179255 AAV-CAG-jGCaMP8m-WPRE CAG jGCaMP8m none Constitutive 1, 9, rg* Looger...

...28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2... pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG Jaws GFP Cre dependent 1, 5, rg* Boyden 84446 pAAV-CAG-FLEX-rc...stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a/nEF Synapsin E2 regulatory...Constitutive 1, 2, 5, 9 Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R)-eYFP CAG ChR2/H134R EYFP Cre dependent PHPeB ...Cre dependent 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent...Cre dependent 9 Harvey 108912 pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3 CAG ChroME (soma-targeted) mRuby3 Cre...AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato...

...none 1 Cepko 183412 pAAV-CAG-FlpO CAG none 1, rg* Janelia VCre AAV ID Name Promoter Fluorophore/Tag Serotype...Deisseroth Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI CaMKII Promoter 105551 pENN.AAV.CamKII.... Cepko GFAP Promoter 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson rTH Promoter 107788 AAV.rTH.PI.Cre.SV40..., rg* Wilson PGK Promoter 24593 AAV-pgk-Cre PGK none rg* Aebischer Synapsin Promoter 51507 AAV pmSyn1-...used to control gene expression. Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)...DreO-bGHpA Syn none 5, rg* Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...pENN.AAV.CamKII 0.4.Cre.SV40 CamKII none 1, 5, 9 Wilson CMV Promoter 105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2,...

...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...luciferase with a V5 tag Kevin Janes 83281 pAAV-CAG-FLuc Firefly CAG AAV expression of firefly luciferase Mark...firefly luciferase Nicole Paulk 98294 pF CAG luc IRES neo Firefly CAG Lentiviral expression of firefly luciferase...luciferase Paul Schulze-Lefert 83282 pAAV-CAG-RLuc Renilla CAG AAV expression of renilla luciferase Mark...investigate the effect of regulatory elements, such as promoters, enhancers and untranslated regions, or the effect...available that are driven by a strong constitutive promoter and can be used to monitor transfection or viral...plasmids by using the bacterial ORI as the core promoter, which was a source of false positives with the...

...the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7 promoter. Truncations...directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed for in vitro...DNA sequences within core promoter regions. pTAL5-BB contains the GAL1 promoter, placing TALORs built into...fragment for blue/white-screening in E.coli , (iii) CAG promoter and Kozak sequence to drive efficient TALEN ...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs built...double-transfected mammalian cells. In addition, a T7 promoter was included for generating TALEN mRNAs through...expression. The vectors listed below have the EF1α promoter for efficient mammalian cell expression, and encode...

...Name Promoter Activity Category PI Controls 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE...pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE CAG GCaMP7s, Cre-dependent Calcium sensor Kim 104496 pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE...pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE CAG GCaMP8s, Cre-dependent Calcium sensor GENIE 162381 pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE...-WPRE CAG GCaMP8m, Cre-dependent Calcium sensor GENIE 162382 pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE CAG GCaMP8f...179254 AAV-CAG-jGCaMP8f-WPRE EF1a GCaMP8f Calcium sensor Looger 179255 AAV-CAG-jGCaMP8m-WPRE CAG GCaMP8m ...mCherry, Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP...pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV...

... Boyden ) and direct GFP expression from the CAG promoter. For information about each catalog item, including...example, AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV...direct EGFP expression from the human synpasin promoter. For information about each catalog item, including...

...pLVCT-tTR-KRAB 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On ...2SM2 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off...generation; Transgene (hEF-1alpha promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2nd generation; Transgene (hPrion promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...

...cells. Expression of this fusion is driven by a CAG promoter. Note that the FokI-dCas9 fusion encoded by ... transcript whose expression is driven by a U6 promoter. The two gRNAs expressed are flanked by Csy4 recognition...

...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...vector (PGK1 promoter, 2μ) pXP316 - Yeast expression vector (TEF1 promoter, CEN/ARS) pAG304GAL-ccdB...vector (PGK1 promoter, CEN/ARS) pXP222 - Yeast expression vector (PGK1 promoter, 2μ) pAG305GAL-ccdB...Representative Empty Backbones Promoter Measure promoter strength pBV-Luc - Luciferase ...Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG pSG5L Flag HA - Transient expression... vectors with various markers, promoters, etc pRS420 - Yeast expression ... expression under the metallothionein promoter pACU2 - Modified pUAST vector containing...

...Expression of SARS-CoV-2 orf3a protein Krogan 141347 pBOB-CAG-SARS-CoV2-Spike-HA Expression of SARS-CoV-2 spike...Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Zhang Cas9 and Accessories...3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro Campeau Return to top Don’t See What You...

... Other Promoter CMV T7 polH GAL Other Clear Filters Addgene ID Plasmid Name Gene Tags Promoter Disease...Friedreich ataxia Michael Ristow 14994 pDRIVE-CAG-hFX-HA FXN HA, AU1 CAG Friedreich ataxia Michael Ristow 15239...wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 NOTAG1 TARDBP CAG ALS Zuoshang Xu 28207 TDP43...TDP43 NOTAG2 TARDBP CAG ALS Zuoshang Xu 28208 TDP43 NOTAG3 TARDBP CAG ALS Zuoshang Xu 28209 TDP43 NOTAG6...NOTAG6 TARDBP CAG ALS Zuoshang Xu 28210 TDP43 NOTAG11 TARDBP CAG ALS Zuoshang Xu 29340 pcDNA3.1/GS-DJ1-R98Q-V5...30137 pCAX APP 695 APP CAG Alzheimer's Dennis Selkoe 30138 pCAX APP 751 APP CAG Alzheimer's Dennis Selkoe...pCAX APP delta CT APP CAG Alzheimer's Dennis Selkoe 30144 pCAX APP AENATA APP CAG Alzheimer's Dennis Selkoe...

... H. sapiens GCAGGTAGCAAAGTGACGCCGA 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae...cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT.... pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949...S. cerevisiae TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...scaffold S. pyogenes 25533786 Qi & Lim TET promoter TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981... or repression experiments use targets within promoters. When possible, the categories described on Addgene's...