We narrowed to 26 results for: AAT
-
TypeCollection...primers: FW 5'–GGTGACGGTGCTGGTTTA–3' RV 5'–TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication...
-
AAV Molecular Tools
TypeCollection...System Activity Serotype PI 58376 pAAV/D377Y-mPCSK9 hAAT-driven, constitutive Expression of mutant (D377Y... -
Sequencing Primers
TypeGuide...forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG T7 promoter, forward...Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen...reverse primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG T7 promoter, forward...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab) Human...to 3′. Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 ... -
Promoters
TypeGuide... which usually consists of the six nucleotides, TATAAT. Proximal Promoter Further upstream from the core...equivalent to the eukaryotic TATA box, the Pribnow box (TATAAT) is located at the -10 position and is essential... -
Fluorescent Protein Guide: Biosensors
TypeCollection...sensors. Science. 2018 Jun 29;360(6396). pii: science.aat4422. Lin Tian Dopamine Yellow or Red genetically... -
Neurodegeneration Plasmid Collection
TypeCollection... Ataxia telangiectasia Michael Kastan 32813 CMV-hEAAT1 SLC1A3 CMV Episodic ataxia Susan Amara 32868 SETD1A...APP751 APP Alzheimer's Wade Harper 194004 VPS13D(deltaATG2-C/PH)^EGFP VPS13D GFP CMV Spinocerebellar Ataxia...