Skip to main content
Addgene

We narrowed to 67 results for: CMV

Showing: 21 - 40 of 67 results
  1. Lentivirus Plasmids

    Type
    Collection
    ...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression... added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression...plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive...for more variations. Campeau 39481 pLenti-puro 3rd CMV driven expression of cDNA. Puro selection. Shih 25737...puromycin Sabatini 25895 pLX301 3rd Gateway plasmid for CMV driven expression of cDNA. See article for alternative...
  2. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/TO Zeo DEST...genome pAdTrack-CMV - Shuttle vector for transgene expression under a CMV ...pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter...Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient expression - Gradia...expression, Ligation Independent Cloning (LIC) pAG CMV Empty Puro - Empty mammalian expression plasmid for...Plasmids and Resources collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids... promoter, GFP-Zeo pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination...
  3. Retrovirus Plasmids

    Type
    Collection
    ...and env Verma 35614 pBS-CMV-gagpol Packaging MoMLV gag and pol Salmon 8454 pCMV-VSV-G Envelope Envelope... Puro resistance. Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A ...Cre fusion in mammalian cells Foijer 47916 pRXTN CMV/MSV pRXTN is a modified version of pRX-tight Puro...containing retroviral plasmid Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA; expresses ...additional plasmids in this toolkit. Lowe 64865 pLncEXP CMV/MSV lncRNA expression plasmid Sun 60683 pLXIN-Luc...
  4. MXS Chaining

    Type
    Blog Post
    ...structures (Table 1). Each construct was flanked with a CMV promoter (to drive high-level expression) and a polyA...
  5. Plasmids 101: Gateway Cloning

    Type
    Blog Post
    ...lentiviral expression, we could use a vector like pLenti CMV Puro DEST (w118-1) or the doxycycline-inducible pLIX...
  6. Tetracycline Inducible Expression

    Type
    Collection
    ...Alexeyev 17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV promoter TetR ...contains a TRE between two minimal CMV promoters. None Pbi (TRE, miniCMV) Bert Vogelstein Transactivators...features seven copies of tet O upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters...placing seven copies of tet O upstream of the minimal CMV promoter. In the absence of tetracycline, tTA binds...Plasmid Description Transactivator PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral Tet-On vector with...-Tet3G blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON...Jaenisch 25434 pMA2640 Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced...
  7. Control AAV Preps

    Type
    Collection
    ...105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase...Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10... 5, 8, rg*, PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 Wilson...CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other...
  8. AAV Molecular Tools

    Type
    Collection
    ...Activity Serotype PI 61592 pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of...tag). 8 Jonathan Long 160857 pAAV-FLEx-ER-TurboID CMV-driven, Cre-dependent Cre-dependent expression of...
  9. Recombinases AAV Preps

    Type
    Collection
    ...Wilson 105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not a fusion tag)...
  10. Lentiviral Prep Service

    Type
    Collection
    ...17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter,...
  11. Sequencing Primers

    Type
    Guide
    ... Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward primer Luc-F AGTCAAGTAACAACCGCGA...MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer...
  12. TALEN Expression Vectors

    Type
    Collection
    ...same). All expression vectors listed below have the CMV promoter for mammalian cell expression and a T7 promoter...
  13. Zhang Lab CRISPR Page

    Type
    Collection
    ...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...
Showing: 21 - 40 of 67 results