Skip to main content
Addgene

We narrowed to 4 results for: CMV

Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ... Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward primer Luc-F AGTCAAGTAACAACCGCGA...MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation...fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between... LTRs and replaced with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter...hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started..., including: Lymphocytic Choriomeningitis Virus (LCMV) – less toxic and inflammatory; targets wide range...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...and replaced with a heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter...hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started...
  4. Promoters

    Type
    Guide
    ...Used in Research Promoter Expression Description CMV Constitutive Strong mammalian promoter from human...
Showing: 1 - 4 of 4 results