Skip to main content
Addgene

We narrowed to 922 results for: IRE

Showing: 21 - 40 of 922 results
  1. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ...post, we will describe the mechanism of homology directed repair, one of the repair pathways of DSBs, with...genome modification purposes. How does homology directed repair fix DNA double-strand breaks?  In eukaryotic...Non-Homologous End-Joining (NHEJ) and Homology Directed Repair (HDR). NHEJ is the canonical homology-independent...-independent pathway as it involves the direct ligation of sticky or blunt ends and often introduces small...This will serve as both a substrate for proteins required for strand invasion and a primer for DNA repair...resolve to complete the DNA repair process Homology directed repair pathways HDR mechanisms can be divided ...an error prone mechanism that notably does not require a donor template and thus won’t be covered in detail...
  2. Antibodies 101: Antibody Engineering and Directed Evolution

    Type
    Blog Post
    ...Structure-guided directed evolution If you desire a bit more control, structure guided directed evolution might... with BioRender.com.   Antibody directed evolution Directed evolution is a method employed to rapidly...antibody-based therapeutics. Whether antibodies are used directly as therapeutic agents or serve as vehicles for...technique we haven’t discussed in depth is antibody directed evolution. This is a larger process of gradually... primers, gene shuffling, and structure-guided directed evolution. The nice thing about these methods ... Figure 2: General process of antibody directed evolution. Created with BioRender.com.   ...strengths of rational design with the power of directed evolution, all while maintaining a higher degree...
  3. The PAM Requirement and Expanding CRISPR Beyond SpCas9

    Type
    Blog Post
    ...updated Aug 20, 2020. Cas9 can be used to modify any desired genomic target provided that (1) the sequence is...signal for Cas9 and this sequence is a strict requirement for Cas9-mediated DNA cleavage. The need for... may be unintentionally mutated along with the desired target locus. The PAM sequence is of particular...concern when trying to edit a gene using homology directed repair, since HDR-mediated gene editing is most...Cas13 enzymes are advantageous because they do not require a PAM, and RNA targeting is potentially reversible...since there is no genomic edit. Some Cas13 enzymes require a single base protospacer flanking sequence (PFS...
  4. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ...below. The complexity and challenges of homology directed repair (HDR) are echoed in the amount of interest...designing a repair template that contains your desired edit, and I want to make sure that I (and Addgene...out this RNP protocol on Protocols.io. The PAM Requirement and Expanding CRISPR Beyond SpCas9 The closer...
  5. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

    Type
    Blog Post
    ...  But llama immunization has its drawbacks: it requires a camelid animal facility which can be expensive...spike protein (Walter et al., 2020). No llamas required. The advantages of synthetic nanobodies Nanobodies... because they have fewer hydrophilic surfaces, require detergents or lipids to remain folded, and are ...regions that bind to the antigen. The Seeger lab can directly provide the three sybody libraries in the form...
  6. Q&A With Julie Cicalese, the Newest Member of the Addgene Board of Directors

    Type
    Blog Post
    ...welcome Julie Cicalese to the Addgene Board of Directors. Cicalese served as the Chief Human Resource Officer...School. The addition of Cicalese to the Board of Directors brings human resources experience and insight ...me to join the committee because I had recently retired from Harvard, and it let me keep my toe in the ...little bit?”    What are you doing to enjoy your retirement? I’m also on the advisory board for Art in Giving... Meet the other members of Addgene's Board of Directors Find careers at Addgene ...
  7. CRISPR 101: Cas9 Nickase Design and Homology Directed Repair

    Type
    Blog Post
    ...demonstrated how CRISPR nickases improve homology directed repair rates, and share their design rules for...PAM-out design.  Exploring nickases for homology directed repair The potential benefit of using nickases...could this system mediate repair throughout the entire region between the nicks? To find out, Schubert... if there are no available guides close to the desired mutation site. Quick tips for nickase design Ready...Resources on the Addgene Blog Learn about Homology Directed Repair 3 Tips to Improve HDR Efficiency How to...
  8. Phage Directory: From Phage Therapy to a Repository of Phage Information

    Type
    Blog Post
    ...search of phages for therapy Phage Directory started out as a directory of phage researchers and the phages...can be sent out to the directory earlier, but the researchers in the directory are volunteering their ...says. As the labs in the directory step forward to help, the Phage Directory team must decide which labs...). The pair quickly teamed up to create Phage Directory in a whirlwind three days in November 2017. ...find much-needed phages for patients.   A phage directory is crucial because it's hard to find the right...a last resort, so a request for phages to the directory does not typically come out until nearly the last... and information Since the inception of Phage Directory ~1 year ago, Sacher and Zheng found that they ...
  9. Q&A with Karen Katz and Carl Paratore, the Newest Members of the Addgene Board of Directors

    Type
    Blog Post
    ..., MBA, CPA to the Addgene Board of Directors. Katz is the Director of Intellectual Property Programs at...addition of Katz and Paratore onto the Board of Directors brings complementary experience and insight to...plasmids and other necessary information that’s required to do research. Paratore: What I’ve been most ...you tell me a bit about your job? Katz: I’m the Director of Intellectual Property Programs at Suffolk University...Learn more about Karen Katz, Esq Ms. Katz is the Director of Intellectual Property Programs at Suffolk University... Meet the other members of Addgene's Board of Directors Find careers at Addgene ...
  10. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro:...pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro) are also in the...M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 ORF3a Lentiviral... See our Serotype Testing AAV inventory for the entire collection! Plasmid Serotype Name Depositor ...
  11. Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools

    Type
    Blog Post
    ... Communications. 2017. PubMed PMID: 28924139. FIRE-Cas9 for inducible interrogation of the epigenome...Article contributed by Joanne Kamens Listen to the Fire-Cas9 Podcast Segment Jerry Crabtree’s lab has developed...Inducible Recruitment for Epigenome editing by Cas9 (FIRE–Cas9), combines these approaches to enable rapid...cell type. By varying which sgRNAs are used with FIRE-Cas9, experiments can be designed to target multiple...analysis of epigenetic memory at nearly any locus. The FIRE-Cas9 plasmids can be found here. Braun et al. Nat...controls expression of transcription factor 2, which directly controls expression of a reporter protein, it ...
  12. New and Upcoming Viral Vectors - June 2019

    Type
    Blog Post
    ...)-mCherry 50467  AAV2 pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine 121538  AAV5 pOTTC1484 - pAAV SYN1 HA-hM4D...Serotype Name 119741  AAV5  AAV SYN flex PSAM4 GlyR IRES EGFP Recombinase AAV Finally, we are excited ...Plasmid Serotype Name 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Chemogenetics... Serotype Name 119472  AAV5  AV SYN PSAM4 GlyR IRES EGFP   Biosensors Plasmid Serotype Name ...in the last few months. You can also browse our entire AAV inventory. Our new AAVs include: Control AAVs...
  13. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...GlyR IRES EGFP Chimeric channels for neuronal manipulation 119742  AAV5  AAV SYN PSAM4 GlyR IRES EGFP...-dependent CRE) 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Calcium sensors...released so far in 2019. You can also browse our entire AAV inventory! Our new AAVs include: pGP-AAV-syn-FLEX-jGCaMP7b-WPRE...neurotransmitter in vertebrates, but methods for directly imaging GABA have been limited. Like calcium sensors...
  14. RaPID Detection of RNA-protein Interactions

    Type
    Blog Post
    ...Element (IRE) RNA motif of the ferritin light chain RNA transcript. IRE motifs are bound by IRE binding...cannot distinguish between proteins that directly or indirectly interact with the bait. Also, RaPID can...binding proteins, IREB1 and IREB2, which post-transcriptionally regulate iron metabolism pathway transcripts...interactions or to analyze chromatin states (CHIP-seq, FAIRE-seq, Cut & Run) and to detect protein-protein interactions...RNA-protein interactions due to sample processing. Require prior knowledge that the protein of interest interacts... methods are not ideal for in vivo work. BirA* requires 16-18 hours to sufficiently biotinylate interacting...found that all HHCS-associated sequences had lower IREB2 binding enrichment compared to wild-type sequences...
  15. Viral Production at Addgene

    Type
    Blog Post
    ...cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes (...expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth (Addgene viral... Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the absence...Control Mycoplasma Our 293T cell line was obtained directly from Takara, and is routinely tested for mycoplasma...
  16. New Viral Vectors - March 2024

    Type
    Blog Post
    ...Biosensor Looger New serotype pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST AAV9 Optogenetics Adesnik New viral vector...
  17. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...doi.org/10.1128/jvi.71.8.6174-6178.1997 Wickersham IR, Finke S, Conzelmann K-K, Callaway EM (2006) Retrograde...–49 . https://doi.org/10.1038/nmeth999 Wickersham IR, Lyon DC, Barnard RJO, Mori T, Finke S, Conzelmann...Infection of these cells with VSV-G pseudotyped virus requires the upregulation of LDLR expression using other...neurons. However, VSV-G’s broad tropism can be undesired for in vivo studies since there’s the potential...neuronal cells and can travel in a retrograde direction from the synapse to the cell body, making it a...use rabies virus is to delete the glycoprotein required for entry into the cell (rabies dG). Because rabies... system (Wickersham et al., 2007). This system requires first supplying rabies glycoprotein along with...
  18. Sequencing Primers

    Type
    Guide
    ...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...
Showing: 21 - 40 of 922 results