Skip to main content

We narrowed to 15 results for: IRE

Showing: 1 - 15 of 15 results
  1. Sequencing Primers

    Type
    Guide
    ...Forward IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES Forward IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse... Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone... Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia vectors...
  2. Adenovirus Guide

    Type
    Guide
    ...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors...got their name, but they are not related. AAVs require the presence of adenoviral genes E1, E4, E2a and... available inside of the adenoviral capsid and directly correlates to the size of the DNA removed from... of genetic cargo. Production of HCAdV vectors requires using an additional adenoviral helper virus (HV...system, recombination between both plasmids occurs directly in the HEK293 packaging cell line, engineered ...of the genome adjacent to the left ITR that is required for viral genome packaging. In helper viruses,...
  3. CRISPR Guide

    Type
    Guide
    ...combination of wild type alleles, NHEJ-repaired alleles, and the desired HDR-edited allele. Therefore, it is...presence of the desired edit experimentally and to isolate clones containing the desired edit (see: Validate...) and the desired edits on a RT template. The PBS base pairs to the 3’ flap, and the desired edit is incorporated...transcription-activator-like effector nucleases (TALENs) required scientists to design and generate a new nuclease...the Cas enzyme. Basic Mechanisms of CRISPR The requirements for a CRISPR knockout assay are simple. You’...continue to anneal to the target DNA in a 3′ to 5′ direction. The location of any potential mismatches matters...of the PAM sequence. The resulting DSB is then repaired by one of two general repair pathways: the efficient...
  4. Plan Your Experiment

    Type
    Guide
    ...BioRender.com. Select Your Desired Genetic Manipulation Different genetic manipulations require different CRISPR...percentage of DNA breaks will be repaired by NHEJ instead of incorporating your desired edit through HDR. Base ...methods and often require screening a larger pool of cells to find one with your desired edit. Lastly, you...base edits Can be paired with restriction enzymes for further customization Usually paired with a sequencing...must be experimentally verified Cut Nick Homology Directed Repair (HDR) Generate specific genomic edits, ...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...Activate Design and Clone Your gRNA Achieving your desired edit comes down to location, location, location...
  5. Antibody Guide

    Type
    Guide
    ...antibodies? Will you be using a direct or indirect detection method? If indirect, do you already have secondary...signal amplification through the indirect detection method. In the direct detection method, the signaling...most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein of...antibody methods, it can be done using either an indirect or direct method. Since IF uses fluorophore color to...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...complex. Due to their increased manufacturing requirements, monoclonal antibodies are typically more expensive... Polyclonal antibodies are typically collected directly from animals and contain antibodies targeting ...
  6. Molecular Biology Reference

    Type
    Guide
    ...as a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous expression...researchers have also expanded the genetic code by redirecting some codons to encode for synthetic amino acids...few hundred or a few thousand base pairs from the entire human genome. Digesting the human genome with restriction...functionality. In their simplest form, plasmids require a bacterial origin of replication ( ori ), an antibiotic...Origin of Replication ( ori ) DNA sequence which directs the initiation of plasmid replication in bacteria... strand. Mimicking the DNA replication process requires the four nucleotides (dNTPs), a DNA polymerase...synthesis after their incorporation. Sanger sequencing requires a lot of DNA because the ultimate goal is to have...
  7. Guide to Using Pooled Libraries

    Type
    Guide
    ...binding partners Supports directed evolution Limitations Protein-specific, may require specialized systems ... and allow you to design additional hypothesis-directed experiments. Barcoding libraries contain plasmids...information on genes unless combined with perturbations Requires deep sequencing Must maintain high representation...nonfunctional. Activation : CRISPR activation libraries direct an inactive Cas enzyme fused to a transcriptional...chromatin. Inhibition : CRISPR inhibition libraries direct an inactive Cas enzyme (alone or fused to a transcriptional...Essential genes may complicate knockout screens Requires Cas machinery, which may need to be expressed ...expressed separately Large number of cells required to ensure adequate representation of every guide Screening...
  8. Lentiviral Vector Guide

    Type
    Guide
    ...the laboratory, the non-required components have been removed, and the required components have been separated...genes. However, they are different viruses and require different isoforms of these packaging components...particles. Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific...and wild-type LTRs Packaging plasmid — contains entire viral genome (packaging, regulatory, and accessory...as a promoter on the transfer plasmid, and this requires Tat for activation. Second-generation plasmids... to the additional plasmid. Second, tat is not required in the third-generation system. Instead, the transfer...plasmids instead of three and eliminates the requirement for Tat. Always includes deletion in the 3' LTR...
  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...got their name, but they are not related. AAVs require the presence of adenoviral genes E1, E4, E2a and...space available inside of the small AAV capsid and directly correlates to the size of the DNA removed from...adenoviral genes not present in the AAV genome required for viral replication (E4, E2a and VA). These ...AAV Plasmid Elements table . Figure 2: Plasmids required for rAAV vector production. AAV Vector Production...central (CNS) nervous systems. Targeting the CNS requires crossing the blood-brain barrier (BBB), and a ... in-stock viral preps . AAV retrograde (AAVrg) Directed evolution has also been employed to engineer an...transport, AAVrg. Retrograde transport refers to the direction of movement within a neuron from the terminal ...
  10. Molecular Cloning Techniques

    Type
    Guide
    ...for it to then be digested and ligated into your desired plasmid. It is important to note that restriction...enzymes that cut your insert or backbone at only the desired location for your cloning project. Restriction ...simplifying the process and reducing the amount of time required for cloning. To utilize this approach, the fragment...gene of interest one time into a donor plasmid or acquire one that already has your gene in it. Then you ...advantages of type IIS systems are two-fold. First, the entire cloning step (digestion and ligation) can be carried...overhangs will be distinct and preserve the directionality of the cloning reaction. Second, the restriction...sequences are removed from the final product, with no undesired sequence ("scar") retained. A disadvantage of ...
  11. Chemogenetics Guide

    Type
    Guide
    ...through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect. DREADD ligands affect signaling... DREADDs in experiments in this species may be entirely due to back-metabolism of CNO to clozapine, demonstrating...that all respond to the same ligands was that bidirectional experiments (that is, using both activating ...hM3Dq can be used in the same organism to allow bidirectional control of neuronal activity. Table 1: Descriptions...Unlike DREADDs, which manipulate neuronal activity indirectly through GPCR signaling, another class of chemogenetic...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels arePharmacologically... CJ, Lee PH, Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson...
  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...genes. However, they are different viruses and require different isoforms of these packaging components... , pol , and env . The LTRs flank all of these required genes, and anything in between will be integrated...genome. To produce gamma-retroviral vectors, these required components have been separated into distinct plasmids...HEK293T Gamma-retroviral vectors can be packaged directly in human embryonic kidney 293T (HEK293T) cells...therefore, reduces the number of plasmids that are required in the transfection step of the viral packaging... gene therapy applications to more specifically direct delivery of gene therapies. Common Uses of Gamma-Retroviral...
  13. Promoters

    Type
    Guide
    ...bacteriophage; requires T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA ...eukaryotes. In bacteria, the core RNA polymerase requires an associated sigma factor for promoter recognition...in eukaryotes is much more complex. Eukaryotes require a minimum of seven transcription factors in order...Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often...
  14. Optogenetics Guide

    Type
    Guide
    ...depolarization of neurons upon exposure to light through direct stimulation of ion channels. Naturally occurring...Halorhodopsins Halorhodopsins are light-gated, inward-directed chloride pumps isolated from halobacteria. Wild-type...). Color of Illumination Light Different tools require different activation wavelengths, which may have...Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Nat Methods...
  15. Modular Cloning Guide

    Type
    Guide
    ...assembly step, compatible Level 0 parts are directionally assembled into a Level 1 vector creating a single...highly-tunable GPCR-based biosensors in yeast (requires MoClo-YTK parts for use). Yeast GoldenBraid Cloning...
Showing: 1 - 15 of 15 results