We narrowed to 52 results for: MSC

1. Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

   Type

   Blog Post

   ...the other hand, mScarlet-I shows correct ER labeling, which is good evidence that mScarlet-I acts as a monomer...

2. Popular Retroviral Vectors and Their Uses in Scientific Research

   Type

   Blog Post

   ..., MMLV, MuLV, or MLV) or Murine Stem Cell Virus (MSCV) genomes whereas lentiviral vectors are derived ...retroviral plasmids (based on the Murine Stem Cell Virus, MSCV) each with a unique 6 nucleotide barcode. This collection...

3. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

   Type

   Blog Post

   ...ShadowR is used as a FRET acceptor to mRuby2 or mScarlet. Image: Murakoshi et al., 2019. ShadowR is ... a FRET acceptor in combination with mRuby2 or mScarlet as the donor in HeLa cells.   Find ShadowR for...

4. Magnetic Control of Proteins: More than a Dream

   Type

   Blog Post

   ...proteins that had shown magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random...semi-random mutagenesis and screening, the EGFP and mScarlet variants were showing no obvious signs of improved...

5. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

   Type

   Blog Post

   ... Figure 4: Reporters in Gene On include a mScarlet reporter, luciferase reporter, and neomycin resistance...translation of an array of different reporters including mScarlet-I, luciferase, antibiotic resistance markers, ...

6. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

   Type

   Blog Post

   ...cells include: mTurquoise2, mEGFP, mNeonGreen, mScarlet(-I), and mCherry. Keep the linker sequence short...instance, Lifeact-mTurquoise2 (Plasmid #36201) or mScarlet-tubulin (Plasmid #85045). We often use restriction...

7. Easi-CRISPR: Generating Knock-In and Conditional Mouse Models

   Type

   Blog Post

   ...the example at right using blue flame plasmid pmScarlet_C1! After creating the T7-DNA template, you'd use...right homology arm to the desired insert (e.g., mScarlet).   Plasmid ID Plasmid Name Tags ...

8. Fluorescent Protein Guide: Subcellular Localization

   Type

   Collection

   ... Gadella 85053 pmScarlet-i_H2A_C1 Nucleus H2A mScarlet-I Dorus Gadella 85052 pmScarlet-H_H2A_C1 Nucleus...Nucleus H2A mScarlet-H Dorus Gadella 85051 pmScarlet_H2A_C1 Nucleus H2A mScarlet Dorus Gadella 18982 pHIV-...Bruchez 85065 pmScarlet-I_peroxisome_C1 Peroxisome SRL mScarlet-I Dorus Gadella 85064 pmScarlet-H_peroxisome_C1...Peroxisome SRL mScarlet-H Dorus Gadella 85063 pmScarlet_peroxisome_C1 Peroxisome SRL mScarlet Dorus Gadella...85045 pmScarlet_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet Dorus Gadella 85046 pmScarlet-H_alphaTubulin_C1...alpha-tubulin mScarlet-H Dorus Gadella 85047 pmScarlet-i_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet-I Dorus...85054 pLifeAct_mScarlet_N1 Actin Filaments LifeAct mScarlet Dorus Gadella 85055 pLifeAct_mScarlet-H_N1 ...

9. Optogenetics AAV Preps

   Type

   Collection

   ...pAAV_hSyn-PdCO-mScarlet-WPRE Syn PdCO mScarlet Constitutive 1, 5 Yizhar 198511 pAAV_hSyn-DIO-PdCO-mScarlet-WPRE ...124650 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 CaMKII C1V1 (t/t) mScarlet Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP...pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 CaMKII ChrimsonR (soma-targeted) mScarlet Constitutive 1, 9 Harvey...pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE CamKII ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive...-hSyn-ChRmine-mScarlet-Kv2.1-WPRE Syn ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8...pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE EF1a ChRmine (high-photocurrent, red-shifted) mScarlet Cre dependent 1,...137158 pAAV-nEF-ChRmine-mScarlet nEF ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Deisseroth...

10. New Viral Vectors - Spring 2025

    Type

    Blog Post

    ...Jordane Dimidschstein New serotype pAAV_hSyn-PdCO-mScarlet-WPRE AAV1 Optogenetics Ofer Yizhar New viral ...

11. Retrovirus Plasmids

    Type

    Collection

    ...Iglehart 20672 MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES...-GFP_2.0 MSCV Retroviral construct for miRNA expression Chen 52114 pMSCV-IRES-mCherry FP MSCV A bicistronic... Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid; deletion of...fused to eGFP expression Clevers 18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression; also...IRES GFP empty plasmid) MSCV For cloning and gene expression; select with puromycin or screen for GFP Bartel...also expresses luciferase Lowe 9044 pMIG MSCV Plasmid for transgene expression; also expresses GFP. Also...

12. Fluorescent Protein Guide: Empty Backbones

    Type

    Collection

    ...Expression mScarlet-I3 568 592 68 4.2 2 min Monomer pmScarlet-I3_C1 - Mammalian Expression mScarlet3 569 592...Monomer pmScarlet3_C1 - Mammalian Expression mScarlet 569 594 71 5.3 2.9 hr Monomer pmScarlet_C1 - Mammalian...Maturation Structure Plasmids mScarlet-H 551 592 15 4.8 4.4 hr Monomer pmScarlet-H_C1 - Mammalian Expression...Mammalian Expression pCS2+mScarlet-C Cloning Vector - Mammalian Expression mScarlet-I 569 593 57 5.4 36 min...min Monomer pmScarlet-i_C1 - Mammalian Expression mStrawberry 574 596 26 4.5 50 min Monomer mStrawberry-N1...

13. Sequencing Primers

    Type

    Guide

    ...primer MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine ...

14. A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light

    Type

    Blog Post

    ...References and Resources References Romano E, Baumschlager A, Akmeriç EB, Palanisamy N, Houmani M, Schmidt...

15. New Viral Vectors - Winter 2025

    Type

    Blog Post

    ...Deisseroth New viral prep pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE AAVrg Optogenetics Ofer Yizhar New serotype...

16. New and Upcoming Viral Vectors - December 2019

    Type

    Blog Post

    ...WPRE-SV40 124650 AAV9 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 55645 AAV5 pAAV-hSyn Con/Fon hChR2(H134R...

17. New and Upcoming Viral Vectors - September 2019

    Type

    Blog Post

    ...near the target site.” pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 (124651-AAV9) Recombinase AAV Targeting...

18. New and Upcoming Viral Vectors - June 2019

    Type

    Blog Post

    ...Serotype Name 124651  AAV9  pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 124603  AAV9  pAAV-EF1a-DIO-ChrimsonR-...

19. Plasmids 101: Methylation and Restriction Enzymes

    Type

    Blog Post

    ...overlapping methylation Not affected Not affected MscI Not affected Blocked by overlapping methylation ...

20. Control AAV Preps

    Type

    Collection

    ...pAAV-CaMKIIa-mScarlet CamKIIa mScarlet Constitutive 8 Deisseroth 131001 pAAV-hSyn-mScarlet Syn mScarlet Constitutive..., 8, 9, rg* Harvey 131002 pAAV-Ef1a-DIO mScarlet EF1a mScarlet Cre dependent 1, 5 Deisseroth 50457 pAAV-hSyn-DIO-EGFP...