Skip to main content
Addgene

We narrowed to 1 result for: MSC

Showing: 1 - 1 of 1 results
  1. Sequencing Primers

    Type
    Guide
    ...primer MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine ...
Showing: 1 - 1 of 1 results