Skip to main content
Addgene

We narrowed to 143 results for: Mycs

Showing: 21 - 40 of 143 results
  1. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ... T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann...YFP, Strep, TEV-V5) with either blasticidin or puromycin selection. Researchers at the Allen Institute ...
  2. Hot Plasmids February 2024

    Type
    Blog Post
    ...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...
  3. All Antibodies

    Type
    Collection
    ...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting...
  4. Luciferase Plasmid Collection

    Type
    Collection
    ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen ...
  5. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...lentiviral supernatant and selected with puromycin. Puromycin-resistant cells were fixed and labeled with...or C-terminal HA tag. Selectable and stable: A puromycin resistance gene makes stable cell line creation...
  6. Sequencing Primers

    Type
    Guide
    ... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...
  7. Tetracycline Inducible Expression

    Type
    Collection
    ...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...blasticidin selection. See Plasmid #26730 for hygromycin selection. rtTA3 Eric Campeau 128061 pLVX-Tet3G...
  8. Zebrafish Plasmid Collection

    Type
    Collection
    ...either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 ...
  9. Cre-lox system

    Type
    Collection
    ...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion...Capecchi 116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre...
  10. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...fragment with FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting in a rapamycin-inducible Cas9...Addgene: Rapamycin-inducible Cas9 sets (Addgene plasmids 62883 &62884; 62885 & 62886) Rapamycin-inducible...separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...Cas9 for genome editing. Without rapamycin treatment, the Cas9(N)-FRB-NES fragment is actively shuttled...to the nuclear export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS...
  11. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...Library 159391 Knockout Mouse Moffat 3rd 4 182 Mycobacterium tuberculosis CRISPRi Library (RLC12) 163954 ...Inhibition M. tuberculosis Rock NA Varies 96,700 Mycobacterium smegmatis CRISPRi Library (RLC11) 163955 Inhibition...
  12. Molecular Biology Reference

    Type
    Guide
    ...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...EtOH) 25 µg/mL Hygromycin B 200 mg/mL 200 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...
  13. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...deposited HA tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al...pharmaceutical industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production...designed to complement unused auxotrophies in Saccharomyces strains by compensating for histidine (HIS3)...
Showing: 21 - 40 of 143 results