Skip to main content

We narrowed to 45 results for: N-EGFP

Showing: 21 - 40 of 45 results
  1. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...blue fluorescent protein 35S-eGFP-nosT - Transient expression vector for eGFP in plants Find FP tagging ...Lentiviral shRNA expression pLJM1-EGFP - 3rd gen lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin...that adds an N-terminal myristoylation signal GST Protein purification pEBG - N-terminal GST... N-terminal His6-GST-TEV for bacterial expression pDest-565 - N-terminal ...Expresses mCherry tag in mammalian cells pBI-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones...proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression pLV-mCherry...tag pNIC-GST-TEV-GG - Cloning of target gene with N-terminal GST tag and TEV cleavage Transient expression...
  2. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...Mammalian U6 yes, cut N. meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1 64116 Mammalian/Lentiviral U6 none N. meningitidis...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1 64118 Mammalian/Lentiviral U6 none N. meningitidis...cut N. meningitidis Joung Cas9 sgRNA vector 68463 Mammalian U6 none S. pyogenes Zhang Cas9/pTREX-n 68708...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence...
  3. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ...library containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP...second plasmid containing the homology arms and an N- or C-terminal tag. The two PCR reactions are then...stably expressing Cas9. This PCR toolkit offers C- and N-terminal tagging vectors (eg GFP, Flag, YFP, Strep...
  4. Light Sheet Fluorescence Microscopy

    Type
    Blog Post
    ... nerve afferents labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical.... Pubmed. H.-U. Dodt, U. Leischner, A. Schierloh, N. Jährling, C.P. Mauch,  K. Deininger, et al. (2007...Medicine, 18, 166–171. Pubmed. A. Ertürk, K. Becker, N. Jährlin, C.P. Mauch, C.D. Hojer, J.G. Egen, F. Hellal...
  5. Validated gRNA Sequences

    Type
    Collection
    ...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...26918244 Lu PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun PDS1 N. benthamiana...
  6. CRISPR Plasmids - Tagging

    Type
    Collection
    ...provided detailed protocols for N- or C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...Doyon's lab deposited a plasmid which introduces an N- or C- terminal affinity tag (3xFLAG-2xSTREP) on endogenous...
  7. Easi-CRISPR: Generating Knock-In and Conditional Mouse Models

    Type
    Blog Post
    ...Plasmid Name Tags 69090 pMJ915 MBP (N terminal); 6xHis (N terminal); 2xNLS (C terminal) 47327 ...commonly used cassettes, such as fluorescent proteins (EGFP, mCherry etc.), recombinases (Cre, Flp etc.), and...62934 pET-NLS-Cas9-6xHis 6xHis (C terminal); NLS (N terminal)   Easi-CRISPR efficiency and delivery...
  8. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1...14121 pcDNA3-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP...Dantuma 23971 VCP(wt)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23972 VCP(R155H)-EGFP VCP His, GFP, HA CMV...Dantuma 23973 VCP(A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(DK0)-EGFP VCP His, GFP, HA CMV...Merrifield 28195 tdp43-EGFP construct2 TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP...Zuoshang Xu 28197 tdp43-EGFP construct4 TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP...Zuoshang Xu 28199 tdp43-EGFP construct6 TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP...
  9. Zhang Lab CRISPR Page

    Type
    Collection
    ... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted...
  10. Tetracycline Inducible Expression

    Type
    Collection
    ...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or...Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS Xiaojun Lian 171123 pLVX-TetOne-Puro-GFP...Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS Jason Sheltzer 11651 pLVUT-tTR-KRAB... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ...TLCV2 Lentiviral vector for tet-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf...
  11. Recombinases AAV Preps

    Type
    Collection
    ...9, rh10 James M. Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 James M. Wilson 55632...Syn EBFP 5 Hongkui Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB James... Esteban Engel , Alexander Nectow 69570 pAAV-EF1a-N-CretrcintG EF1a none 1 Connie Cepko 69571 pAAV-EF1a-C-CreintG...
  12. Fluorescent Proteins: FRET

    Type
    Collection
    ...-sREACh-N3 EGFP ShadowY** 488 0.6 531** 136,000 0.01 6.1 4.5 mEGFP-N1 , CMV-ShadowY , EGFP-ShadowY λ Dex...mTFP1-N1 , mCitrine-pBAD EGFP mCherry 488 0.60 610 72,000 0.22 5.3 1.9 mEGFP-N1 , mCherry2-N1 , pcDNA3.1...sReach-mTurquoise2 EGFP sREACh** (super-REACh, aka Nữ) 488 0.60 531** 115,000 0.07 6.0 4.1 mEGFP-N1 , sREACh-...pcDNA3.1 CMV mCherry-eGFP BGH Clover mRuby2 505 0.76 600 113,000 0.38 6.3 4.5 pcDNA3-Clover , pcDNA3-mRuby2...opens in a new window) Algar, W. R., Hildebrandt, N., Vogel, S. S., & Medintz, I. L. (2019). FRET as a...
  13. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ... A. R., Shin, N., Kim, Y., Toong, N., Kaplow, I. M., Wirthlin, M., Zhang, X., Phan, B. N., Fox, G. A.,...s41467-023-38582-7 Chuapoco, M. R., Flytzanis, N. C., Goeden, N., Christopher Octeau, J., Roxas, K. M., Chan.../10.1038/nbt.3440 Goertsen, D., Flytzanis, N. C., Goeden, N., Chuapoco, M. R., Cummins, A., Chen, Y., ...10.1038/s41593-021-00969-4 Goertsen, D., Goeden, N., Flytzanis, N. C., & Gradinaru, V. (2022). Targeting the...Radaelli, C., Gore, B. B., Weed, N., Omstead, V., Bishaw, Y., Shapovalova, N. V., Martinez, R. A., Fong, O...relatively even distribution of target gene expression (EGFP, in the depositing manuscript) across the brain.... AAV9.452sub.LUNG1 Lung: ATII cells Mice N/A Goertsen et al., 2022 AAV.CAP-B22 CNS: neurons...
  14. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...The pCoofy series of plasmids contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep...types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of interest...
  15. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... Bacterial Expression EGFP 488 507 34 6 25 min Prone to dimerization pcDNA3-EGFP - Mammalian Expression...Expression pLV-eGFP - Mammalian Lentiviral Expression Ac5-STABLE1-neo - Insect Expression pCS2+8CeGFP - Zebrafish...Sea urchin pCS2+8NeGFP - Zebrafish/Xenopus/Worm/Sea urchin pKT0128 - Yeast Expression EGFP-pBAD - Bacterial...Expression cfSGFP2 493 517 34 5.4 Monomer (A206K) cfSGFP2-N - Mammalian Expression (cysteine-free SGFP2) ZsGreen...5.4 35 min Prone to dimerization pcDNA3-mNeptune2-N - Mammalian Expression mNeptune2 600 650 21 Prone ...w876-1) - Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo - Xenopus Expression pET51b-His-TEV-HaloTag7 ...w878-1) - Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector -...
  16. CRISPR References and Information

    Type
    Collection
    ...plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for human and...pyogenes Cas9, S. aureus Cas9, S. thermophilus Cas9, N. meningitidis Cas9, or Cas12a from your input sequence...and can work for S. pyogenes , S. thermophilus , or N. meningitidis Cas9 PAMs. Currently supports: mouse...
  17. Luciferase Plasmid Collection

    Type
    Collection
    ... with a fluorophore as the acceptor. LumiFluors: EGFP-NanoLuc ( GpNLuc ) and LSSmOrange-NanoLuc ( OgNLuc... 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning Mikko...87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning. Lentiviral...UTR Carl Novina 33154 pAC-Luc Firefly Creation of N-terminal Firefly fusions in Drosopholia Michael Rosbash... 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning Mikko... John Atkins 174050 pGWB-nLUC Firefly Creation of N-terminal Firefly luciferase fragment for split-luciferase...NanoLuc® CMV Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc...
  18. Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)

    Type
    Blog Post
    ...: 25184501. PubMed Central PMCID: PMC4262738. 3. EGFP gRNA (BRDN0000561167) (Plasmid #80034) and BRAF ...off-target effects of CRISPR-Cas9. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith...
Showing: 21 - 40 of 45 results