Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 420 results for: SUA

Showing: 21 - 40 of 420 results

  1. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ... that has UV light, visualize your DNA fragments. The fragments of DNA are usually referred to as ‘bands...DNA by size (e.g., length in base pairs) for visualization and purification. Electrophoresis uses an electrical.... Pro-Tip TBE can be used instead of TAE, labs usually use one or the other, but there is very little ... concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel...gel). EtBr binds to the DNA and allows you to visualize the DNA under ultraviolet (UV) light. Caution ...loading less DNA into the well. Another method for visualizing very short DNA fragments is polyacrylamide gel...

  2. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...digestion (usually 3-6bp). Restriction Site: Your chosen restriction site for cloning (usually 6-8bp). Hybridization...primer that binds to the sequence to be amplified (usually 18-21bp). When selecting restriction sites, you...the desired location in your recipient plasmid (usually in the Multiple Cloning Site (MCS)), but do not...genomic DNA or a cDNA library), roughly 18-21bp is usually sufficient to give specificity and to also be compatible... run the product on a gel. This allows you to visualize that your PCR product is the anticipated size ...

  3. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...Featured article from Journal of Visualized Experiments (JoVE) about genomic deletions in mammalian cell...to present a video reprint from the Journal of Visualized Experiments (JoVE). The video publication by ...

  4. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ...enzyme is usually better. Mix gently by pipetting. Incubate tube at appropriate temperature (usually 37 °C...requires 1 µg of DNA. The total reaction volume usually varies from 10-50 µL depending on application and...manufacturer's instructions for more details. To visualize the results of your digest, conduct gel electrophoresis...

  5. Validated gRNA Sequences

    Type
    Collection
    ... MUC4 H. sapiens GTGGCGTGACCTGTGGATGCTG 51025 visualize S. pyogenes 24360272 Qi MYOD1 H. sapiens TGGCCTCCCTCCCTGCCCGGTAG...telomeres H. sapiens GTTAGGGTTAGGGTTAGGGTTA 51024 visualize S. pyogenes 24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA...

  6. Protocol - Bacterial Transformation

    Type
    Protocol
    ...transformation efficiency. The lowest efficiency cells (usually the least expensive) are fine for transforming ...incubate in 37°C incubator. Mix 1 - 5 μl of DNA (usually 10 pg - 100 ng) into 20-50 μL of competent cells...into a 42°C water bath for 30-60 secs (45 secs is usually ideal, but this varies depending on the competent...

  7. Hot Plasmids - May 2022

    Type
    Blog Post
    ...developed visual barcodes for clonal multiplexing of cells in live imaging application. Each visual barcode... reduced error rate for long sequence knock-ins Visual barcodes for live cell clonal multiplexing Improving...2022. https://doi.org/10.1038/s41556-021-00836-1 Visual barcodes for live cell clonal multiplexing by: ...different fluorescent proteins, and inserting each visual barcode into its own subclone, they were able to... using freeware.    Fig. 4: Images of 12 visual barcodes in use in A375 cell line. Image from Kaufman...allowing for up to 20-plex experiments with one visual barcode per cell and up to 200-plex with two barcodes... or kinase translocation reporters (KTRs). Find visual barcode plasmids here! Kaufman, et al. 2022. Nature...

  8. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...(AAV), have been used for tracing and visualizing motor, visual, and auditory neuronal circuitry in vivo...away from the site of application and aid in visualization of the morphology of individual neurons, including...colorimetric product or are fluorescent. While dyes usually spread unidirectionally, there are some reports...that their diffusion across the synaptic cleft is usually severely impaired, and only few reports exist about...number of connections, or the “connectome”, to be visualized in a uniform and standardized way (Oh et al.,...An additional desirable property for network visualization would be the ability to spread trans-synaptically...attributes and their use has allowed for the visualization of single connection networks within the rodent...

  9. Neuronal labeling with Spaghetti Monster

    Type
    Blog Post
    ...neuroscience research. The use of genetic tools for visualizing and perturbing circuits together with the development...expressed. As these epitopes tags have no intrinsic visual signal, they cannot be detected directly in live...also use multiple FPs in single experiments and visualize numerous molecules or structures at once (Shaner...multi-color imaging experiments, the second color is usually provided by red fluorescent proteins such as tdTomato...using smFPs and standard neuronal tracers. 2. Visualization of neuronal sub-cellular structures GFP is limited...structures. For instance, smFPs have been used to visualize “thorny excrescence” (TE) spines in the Hippocampal...appear to be very effective probes for finely visualising sub-cellular structures or low-abundance proteins...

  10. Summer SciComm Series: Modes of Communication

    Type
    Blog Post
    ...to high Uses visuals, audios, and text. Incredibly immersive and flexibility to visualize and contextualize...often more suited for cartoons or graphics for visuals. However, it’s much more challenging to design ...from smartphones with low data requirements.  No visuals. Variety of hosting platforms can splinter audience... digitally and physically. Easy to incorporate visuals if needed. Traditional media formats are quite ...  Photography Medium (high for microscopy) Visually compelling. Easy to convey a large number of details...contextualize. Graphics/cartoons (no words) Low Visually compelling and flexible. Can be used to illustrate...

  11. Save Time with Transient Plant Leaf Transformations

    Type
    Blog Post
    ...non-model organisms. Therefore, transient methods are usually the first choice for investigating gene function...In the plant sciences “transient transformation” usual means that neither a stable cell line or plant is... re-invent the wheel. Test different leaf ages Usually younger leaves work better. Not every leaf is equally...with histochemical GUS-staining is a very useful visual reporter (Figure 2). The GUS enzyme cleaves a substrate...which will then form a blue precipitate. GUS is usually the first choice for establishing a new transformation...substrate to produce bioluminescence. Luciferases usually have shorter mRNA and protein half-lives then GUS.... Syringe infiltration (D'Aoust et al., 2009): Usually a syringe without a needle is used to inject an...

  12. Microbes: Look, Listen, and Tell

    Type
    Blog Post
    ...sound to visualize bacteria in the lab, I was excited to learn about creative approaches to visualize bacteria...microbes through a microscope is not the only way to visualize them. You can also “hear” them. Addgene depositor... as bacterial expression of dyes allows dye visualization in vivo using ultrasound (for an example see...showcased complex connections and ideas in various visualized approaches from hand-drawn comics (Dr. Sanja ...interesting and approachable!   The grand finale of visual impressions was delivered by the ASM Agar Art Winners...

  13. Antibodies 101: Introduction to Immunofluorescence

    Type
    Blog Post
    ...ELISA or Western Blotting, but it allows you to visualize a target of interest within an intact cell, tissue...these terms refer to the use of antibodies to visualize a target within an intact sample, a cell in the... case of IHC. IF is used specifically when we visualize the antibodies using fluorescence (for some background... also refer to assays using non-fluorescent visualization methods. Stay tuned for a future blog post to...direct IF, researchers use a single antibody to visualize their target. These antibodies are generated against...fluorescent molecule allowing one to “directly” visualize their target. In contrast, indirect IF requires...antibodies conjugated to distinct fluorophores to visualize multiple targets at once. An advantage of multiplexing...

  14. Plasmids 101: Restriction Cloning

    Type
    Blog Post
    ...the insert ended up in the direction you want - usually by Sanger sequencing or further restriction digests... use a voltage difference across a gel matrix (usually agarose) to pull your negatively charged DNA through... individually. There are a variety of ways to visualize the DNA in your gel (this table is not inclusive...all gel stains):  Stain Pre or Post Run? Visualization Sensitivity (ng DNA) SYBR Safe Pre and Post...respectively). Some of the above stains require you to visualize your DNA using UV light – please note that UV ...personal protective equipment should be worn when visualizing using UV as it can cause damage to the eyes and...backbone alone plate). Unsuccessful ligations will usually result in few colonies on both plates (unsuccessful...

  15. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...the dynamic or working range of a given reagent (usually an antibody).      Figure 1: A protein ...number of helpful suggestions.  Gels Gel issues usually come down to voltage and time. Make sure to load...seeing a smiley face at an appropriate voltage (usually 10–15 V/cm of gel), your gel may be overheating...protein tag or an IgG binding site, allowing you to visualize them with a conjugated antibody. If you do not...with 20% methanol, and place over a light box to visualize proteins after transfer. Troubleshooting The ...with specific blockers, and the manufacturer will usually include recommended blocking conditions on the ... antibodies, the recommended dilution range is usually between 1:5,000 and 1:200,000. Check the manufacturer...

  16. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...studies, which are evinced by the Tet system and visualization of single molecules via targeted fluorescent...2013 August 20th; 14(1). TRICK: A method for visualizing the first round of translation in living cells...anticipate that this tool can also be used to visualize translocations, genome rearrangements and cancer-associated...GFP, BFP and mCherry), the authors were able to visualize simultaneously several parts of the genome and...variety of experiments including subcellular visualization of 6 different organelles, a cell cycle indicator...proteins have been used as subcellular markers to visualize the dynamics and interactions between the endoplasmic...These fusion proteins can act as markers for visualization of subcellular structure, for performing live-cell...

  17. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...marker, studying protein-protein interactions, visualizing promoter activity, and much more. Read on to ...C-terminus of a protein, which allows the scientist to visualize when and where the gene is expressed. Click here...cells in order to understand their activity and visualize the effects of alterations to this activity. Learn...put under control of promoters of interest, to visualize the developmental stage at which these promoters...particular cell populations in drug screens, to visualize micrometastases in nude mice in cancer studies...to label pathogenic intracellular microbes to visualize host/pathogen interactions.   Do you have a favorite...

  18. CRISPR Library Amplification

    Type
    Protocol
    ...organism's genome, for example. Amplification is usually necessary to produce sufficient quantities of library...the shared plasmid backbone a single time and visualize that digestion on an agarose gel ( see restriction...all liquid has been absorbed by the agar. This usually takes 1-2 minutes. Critical Be careful not to rip...

  19. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ... Because the G is only one base, the Zhang lab usually adds it when they order the oligo. If your spacer...single-allelic and bi-allelic cells. Single-allelic cells usually make up the majority in culture unless the targeting...Ran et al. (2013). As for target selection, we usually pick 3–6 guides around the region to find the most...consider using ssDNA oligo as donor template, it's usually more efficient than plasmid donor. Typical design...CRISPR protospacer target in the HR template, you usually would need to make mutations of the HR template...probably a single stranded DNA (ssDNA) oligo which usually work better than plasmids. For ssDNA oligo design...PCR reaction. The gDNA extracted in this way is usually more concentrated than using other kits like the...

  20. SARS-CoV-2/COVID-19 Detection Methods Based on CRISPR/Cas

    Type
    Blog Post
    ... fluorescence is no longer quenched and can be visually detected using lateral flow strips. Since the ...AIOD-CRISPR) assay – for rapid, ultrasensitive and visual detection of novel coronavirus SARS-CoV-2 Sensitivity...machines by DIY-Bio, P51 cardboard fluorescence visualizer with 9V battery Approach :This preprint uses ...cleavage. This cleavage is coupled to fluorescence visualization. In this technique, however, instead of using...the authors employ a P51 cardboard fluorescence visualizer that is powered by a 9V battery which uses a ... Upon binding, changes in fluorescence can be visualised. Another approach was to apply the same concept...
Showing: 21 - 40 of 420 results