We narrowed to 33 results for: T7

...firefly luciferase James Wilson 101156 T7-CMVtrans-FFLuc-polyA Firefly T7 Expression of firefly luciferase ...luciferase. Renilla luciferase is expressed from a T7 promoter for normalization. John Atkins 174050 pGWB-nLUC...

...(aTc) Escherichia coli Stanley Qi 11518 pDest-527 T7-lacO Lactose/IPTG Escherichia coli Dominic Esposito...Escherichia coli Cheryl Arrowsmith 26094 pET28a-LIC T7-lacO Lactose/IPTG Escherichia coli Cheryl Arrowsmith...Escherichia coli Andreas Moeglich 26092 pET15-MHL T7-lacO Lactose/IPTG Escherichia coli Cheryl Arrowsmith...

...The pMAK461-64 plasmids were expressed in SHuffle T7 Express competent E.coli (NEB) using IPTG induction...

... synthetic phages, each based on the well-studied T7 phage, to target various types of bacteria. In mixed...

...transcriptase (RT)-RPA, respectively. RPA is coupled with T7 transcription to convert amplified DNA to RNA for...

...be produced. Many commonly-used promoters, such as T7, CMV, EF1A, and SV40, are always active and thus ...

...DNA into E. coli BL21 (DE3) cells (these have the T7 polymerase and a few proteases knocked out making...

...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...

...Expression Description T7 Constitutive Promoter from T7 bacteriophage; requires T7 RNA polymerase Sp6 Constitutive...

...Tetracycline (Tet) Inducible Expression page Bacteria Lac, T7, araBAD, trp mTagBFP2-pBAD - Protein expression vector...

...Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants, synthetic terminators...

...C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial Expression CLIP-Tag Benzylcytosine...

...Grunwald pCS2TAL3-DD, pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...