Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 30 results for: U6 promoter

Showing: 21 - 30 of 30 results

  1. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...and pX458 modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter ...reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids...shuttle plasmids to insert a second guide within a U6-guide cassette. This process is compatible with all...

  2. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ....org/10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription ...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...

  3. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...47549 pDD162 (Peft-3::Cas9 + Empty sgRNA) R07E5.16 U6 yes, cut Goldstein 42250 DR274 T7 BsaI In vitro transcription...

  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Yildiz 159787 pGL3-U6-pegRNA_KCNA1-EGFP KCNA1 U6 Episodic ataxia Xiaolong Wang 159788 pGL3-U6-sgRNA_KCNA1-mcherry...190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51-7sk-...7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's...Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9 HTT GFP U6, EFS Huntington's Nicole Deglon 191487...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...(BRDN0001145663) TBK1 U6 ALS David Root 76362 TBK1 gRNA (BRDN0001148392) TBK1 U6 ALS David Root 76363 ... (BRDN0001148607) TBK1 U6 ALS David Root 76470 GAK gRNA (BRDN0001146687) GAK U6 Parkinson's David Root...

  5. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...under from the CB promoter pCDH-CB-iCre 72257 Express iCre under from the CB promoter pCDH-CB-FLPe-P2A-...the CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266 ...interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from the CB promoter pCDH-PGK 72268 xpress...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...from the CB promoter pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2... EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7...

  6. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...

  7. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al., ...known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...individual types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of...ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated...

  8. Promoters

    Type
    Guide
    ...Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression ...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...

  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...continuous expansion of compatible backbones, promoters, and genes available to the community. If you ...

  10. Luciferase Plasmid Collection

    Type
    Collection
    ...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...plasmids. ID Plasmid Luciferase Type Promoter Description PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...71248 pXPG Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow... Renilla Dual reporter vector. Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase...
Showing: 21 - 30 of 30 results