Skip to main content

We narrowed to 27 results for: U6 promoter

Showing: 21 - 27 of 27 results
  1. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...under from the CB promoter pCDH-CB-iCre 72257 Express iCre under from the CB promoter pCDH-CB-FLPe-P2A-...the CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266 ...interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from the CB promoter pCDH-PGK 72268 xpress...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...from the CB promoter pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2... EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7...
  2. Sequencing Primers

    Type
    Guide
    ...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F...Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG...
  3. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al., ...known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...individual types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of...ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated...
  4. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...continuous expansion of compatible backbones, promoters, and genes available to the community. If you ...
  5. Luciferase Plasmid Collection

    Type
    Collection
    ...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...plasmids. ID Plasmid Luciferase Type Promoter Description PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...71248 pXPG Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow... Renilla Dual reporter vector. Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase...
  6. Promoters

    Type
    Guide
    ...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...phospholycerate kinase gene U6 Constitutive Mammalian U6 nuclear promoter for small RNA expression (species-specific...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences... binding to the promoter region. Each sigma factor recognizes different core promoter sequences. Figure...
Showing: 21 - 27 of 27 results