We narrowed to 48 results for: YFP tag
-
TypeBlog Post...the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free up crowded...using viral vectors! One of the most significant advantages of viral delivery is the potential for long-term...results in calcium assays. There’s another crucial advantage: tissue-specific targeting. By employing various...
-
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... NLS mCherry Connie Cepko 37341 pQC NLS YFP IX Nucleus NLS YFP Connie Cepko 158000 pCaggs-NLS-PAmCherry1...miRFP703 Vladislav Verkhusha 1816 Lamp1-YFP Lysosomes Lamp1 YFP Walther Mothes 1817 Lamp1-RFP Lysosomes...Bruchez 45944 pTDpelB-C_sfYFPTwinStrep Periplasmic space PelB signal sequence YFP Thorben Dammeyer 54520...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson... -
Plasmids 101: Multicistronic Vectors
TypeBlog Post...pMSCV-pBabeMCS-IRES-RFP IRES Retroviral pMSCV-IRES-YFP II IRES Retroviral pCMMP-MCS-IRES-Puro IRES Retroviral...expressed from the same cassette is sometimes advantageous, particularly when only a portion of the plasmid... mRNA. However, some bicistronic vectors take advantage of an element called an Internal Ribosome Entry...bicistronic vectors; however, they do have some disadvantages. These elements are quite large (500-600 bp)...vector.3 2A Peptides To overcome some of the disadvantages of the IRES element, scientists have adapted... -
CRISPR Plasmids - Tagging
TypeCollection...C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila cells 3.2 MB C terminal tagging in Drosophila... CRISPR Protein Tagging CRISPR Plasmids - Protein Tagging Browse...allow tagging of proteins expressed from their natural chromosomal context. These CRISPR tagging methods...and throughput over traditional tagging methods. Several different tagging techniques, as well as the plasmids...design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System The Eric Mendenhall...deposited plasmids in this CRISPR-Cas tagging system were tested by tagging transcription factors with FLAG ...Protocol 134.7 KB Mendenhall and Myers Tagging Plasmids Protein Species Tag Donor Plasmid gRNA plasmid gRNA ... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Includes tagging with CFP, YFP, and mRFP Tsoulfas Lab Lentiviral Plasmids - Fluorescently tag your gene...Maturation Structure Plasmids EYFP 513 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression Topaz...Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia Lab Bacterial...empty plasmid backbones with different fluorescent tags for you to create fusion proteins with your gene... iRFP Gradia Lab Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab ...C. elegans Hamdoun Lab Plasmids - Set includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95... -
Split Fluorescent Proteins for Studying Protein-Protein Interactions
TypeBlog Post...experiment. Highlighted Split-Fluorescent Protein Tags Browse the table below, and click the Article link...cellular proteins with split fluorescent protein tags. Tamura R, Jiang F, Xie J, Kamiyama D. Commun Biol...most-requested GFP(1-10) and GFP(11) Versatile protein tagging in cells with split fluorescent protein. Kamiyama... monomeric near-infrared fluorescent proteins as tags and biosensors for multiscale imaging. Shcherbakova... Fluorescence-activating and absorption shifting tag (FAST) for use with green-yellow or orange-red fluorogen... -
Hot Plasmids - October 2022
TypeBlog Post...detecting protein tags. And when you think of protein tags, what are the first tags that come to mind...the Myc tag has become one of the most commonly used protein tags - a quick search for ‘Myc tag’ in the...guess that the Myc-tag is one of them (and not just because of the title!) The Myc-tag is a string of 10...Improved voltage indicator: JEDI-2P Novel class of light-gated potassium channelrhodopsins Myc-tag antibody...https://doi.org/10.1101/2021.09.17.460684.) Myc-tag antibody anti-c-Myc [9E10] now available! by: Ashley... 3: Image of Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from Plasmid 98926...imaging of voltages. This includes monitoring of fast bursts, as well as slow up/down voltage states in... -
Fluorescent Proteins 101: Green Fluorescent Protein (GFP)
TypeBlog Post...GFP for a wide number of functions, including: tagging genes for elucidating their expression or localization...technology is constantly being developed! Fusion tagging: One of the most common uses, GFP can be fused ...Purification: GFP can be used as a general epitope tag for protein purification and a number of commercial...Wildtype GFP EGFP F64L; S65T EYFP S65G; V68L; S72A; T203Y mYFP S65G; V68L; Q69K; S72A; T203Y; A206K...however, point mutations are acceptable. GFP's main advantage over conventional fluorescent dyes of the time...began engineering new versions of GFP through mutagenesis in order to improve its physical and biochemical...promoters of interest, to visualize the developmental stage at which these promoters are active. Further, GFP... -
Hot Plasmids - August 2020
TypeBlog Post...generated plasmids tagged with EB3 to mark the growing tips of microtubuli and plasmids tagged with MapTau to... the desired nanobody (NB) sequence, an AviTAG, and 6xHis tag. The MBP signal peptide allows the NB to...sequence-specific protease used to cleave affinity tags from purified recombinant proteins at small and ...cells were transfected with plasmids encoding FPs tagged with the plasma membrane targetin sequence derived...improved genetically encoded fluorescent markers tagged with mTurquoise2, mNeonGreen, and mScarlet-I for...commonly used for in vivo biotinylation via BirA and AviTAG. pMAK contains the signal peptide of MBP, followed...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient... -
Fluorescent Protein Guide: Biosensors
TypeCollection...categories of biosensors or browse all the biosensors tagged in our catalog . Use the article links to find ... 2013 Nov 13;7:202. Colin Akerman Chloride (Cl-) YFP-derived sensor for measuring Cl- concentration in...in physiological range A genetically-encoded YFP sensor with enhanced chloride sensitivity, photostability...by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy. 2007;3(5):452-60. Tamotsu Yoshimori...Super-Ecliptic, pHluorin-mKate2, Tandem Fluorescent Protein-Tagged Human LC3 for the Monitoring of Mammalian Autophagy...Hoffman Voltage JEDI-2P voltage indicator for two-photon imaging Sustained deep-tissue voltage recording...Rafael Yuste Voltage Ultrafast fluorescent voltage sensor ASAP2f Subcellular Imaging of Voltage and Calcium... -
15 Hot Plasmids from 2017
TypeBlog Post...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and...instance, inserting PhoCl in between a protein and a tag, such as an NLS or NES, enables control over localization...deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation mutants...gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression... demonstrate the power of mCyFP1, the Lin and Yasuda groups use both mCyFP1 and EGFP as FRET donors in...smooth endoplasmic reticulum (OSER) assay. A major advantage of mCyRFP1 is its ability to be coexcited along... used a combination of deliberate and random mutagenesis to isolate the best RFP. They targeted known ... -
Sequencing Primers
TypeGuide... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end... -
Brain Armamentarium
TypeCollection...pAAV_BiSSTe4_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by SST interneuron-targeting...pAAV_BiPVe3_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by PV+ basket cell-targeting...pAAV_BiPVe4_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by chandelier cell-targeting...pAAV_BiLAMP5e3_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by Lamp5 interneuron-...pAAV_BiVIPe4_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by VIP interneuron-targeting...pAAV_BiCHATe27_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by cholinergic neuron-targeting...pAAV_BiSSTe10_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by SST interneuron-targeting... -
Fluorescent Protein Guide: FRET
TypeCollection...C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest fused to the C-terminus of SYFP2 Clover ... suitable for creating individual fluorescently tagged proteins to study protein-protein interactions ...Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses mammalian optimized...Cyan Bacterial Expresses CyPet with C-terminal His tag SCFP3A Cyan Mammalian Express a gene of interest ... EYFP connected by 8 GGSGGS repeats pET28CLY9 Peptide linker standard consisting of ECFP and EYFP connected...pET28CLY1 Peptide linker standard consisting of ECFP and EYFP connected by 1 flexible glycine- and serine-containing...pET28CLY2 Peptide linker standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide ... -
New Viral Vectors - Winter 2025
TypeBlog Post...Depositor Notes pAAV.CAGFLEX.(cyto).iATPSnFR2.S29W.A95K.HaloTag AAV5 Biosensor Tim Brown New viral prep ...Biosensor Marianne Fyhn New viral prep pAAV-Ef1a-fDIO EYFP AAV5. AAV8, AAVrg Control Karl Deisseroth New ...Wilson New serotype AiP12237 - pAAV-AiE0452h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2237) AAV-PHPeB Control Jonathan...viral prep AiP12787 - pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) AAV-PHPeB Control Jonathan...New viral prep AiP12610 - pAAV-AiE0780m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2610) AAV-PHPeB Control Jonathan... AiP13755: pAAV-AiE0743m_3xC2-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755) AAV-PHPeB Optogenetics...viral prep AiP14496: pAAV-AiE0873m_3xC2-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN4496) ... -
Control AAV Preps
TypeCollection...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags Activity...non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive...Cre dependent 1 Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Sanes 45186 AAV-EF1a-BbChT... EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061...Constitutive 5 Khakh 105622 pAAV.CamKII(1.3).eYFP.WPRE.hGH CamKII(1.3) eYFP Constitutive 1 Deisseroth 105921 pAAV-CBh-mKate2... 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Gradinaru...Constitutive 9, PHP.eB Feng 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Deisseroth 28306... -
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
TypeBlog Post...Figure 1: Plasmid mix to label neuronal morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) ...expressing fluorescent cytoplasmic markers (e.g. eYFP) and synaptic proteins (e.g. postsynaptic PSD95-... Figure 2: Expression of a morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the ...Properties of FLP Recombinase Evolved by Cycling Mutagenesis.” Nature biotechnology 16(7): 657–62. PubMed ... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...fusion protein. Read more about epitope tags and protein tags . Tag or Fusion Protein Common uses...collection page Return to top Epitope Tag or Fusion Protein Tags and fusion proteins are excellent tools...stop codon for C-terminal tags and omit the start codon for N-terminal tags. And when you are designing... C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG tag in pCS for ...Epitope tag pcDNA3.1-HA or c-Flag pcDNA3 - Mammalian expression vector with N- or C-terminal HA tag pInducer20...bacterial expression; His,GST tag pE2c - Modified pENTR vector for C-terminal 3x HA tag fusion with your gene ...gene of interest in plants Myc Epitope tag pKMyc - N-terminal Myc tag for mammalian expression pGEX-4T-1-... -
Brain Initiative Collection
TypeCollection...Fluorescent reporter for serotonin (dendrite localization tag) Lin Tian 135420-AAV1 pAAV-syn-FLEX-jYCaMP1s Yellow...AAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for...AAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used ...with pAAV-TREtight-mTagBFP2-B19G Ian Wickersham 100799-AAV1 pAAV-TREtight-mTagBFP2-B19G helper virus for...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ... -
Retrograde AAV viral preps
TypeCollection...105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases Wilson 105551 pENN....pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH...pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP, Flp-dependent...Fon/Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth 28306...Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV EF1a... 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ...