We narrowed to 35 results for: loxP
-
TypeBlog Post... Cre recombinase, which induces recombination at LoxP sites. Placing a lox-STOP-lox cassette upstream ...
-
AAVs CREATed for Gene Delivery to the CNS and PNS
TypeBlog Post...the cap gene. In this special CREATE cap plasmid, loxP sites flank the downstream polyA sequence. When ... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...Brainbow 2.1 construct in the Rosa26 locus, under a loxP “roadblock” so that XFP are only expressed following... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Flp recombinases to remove genes flanked by either loxP or FRT sites respectively, and empty vectors to ... -
Bacterial Expression Systems
TypeCollection...Mycobacterium sp. Ashwani Kumar 134405 pBbAW4k-loxP-TT-loxP-mRFP1 Cre recombinase activity Fluorescence ... -
Zhang Lab CRISPR Page
TypeCollection...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination and fluorescence assisted sorting ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid facilitates Cre/loxP recombination and fluorescence assisted sorting ... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...recombination events at the genetic level. Upon Cre/loxP recombination, each transgene expresses one of three...recombinase/FRT system in place of Brainbow’s Cre/loxP, allowing for simultaneous use of the two systems... -
Zebrafish Plasmid Collection
TypeCollection...Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that enables precise temporal and spatial... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...can flank fluorescent proteins in a plasmid with loxP sites such that their expression is turned on or... -
27 Hot Plasmids from 2016
TypeBlog Post...Lab used this backbone to target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus, allowing for... -
Adenovirus Guide
TypeGuide...packaging. In helper viruses, this signal is flanked by loxP sites so they can be excised. Adenoviral plasmid... -
CRISPR History and Development for Genome Engineering
TypeCollection...mutations seen in human patients, protein tags, or loxP/FRT sites, among others. Homology-directed repair... -
Validated gRNA Sequences
TypeCollection...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...terminators and various pieces for inducible expression, loxP sites, H2B, P2A or PEST2D sequences. Several pre-constructed... -
Penn Vector Core Partnership with Addgene
TypeCollection... AV-1-PV2699 100030-AAV1 pAAV.CBA.loxP.ArcLightD.2A.nlsmCherry.loxP.WPRE.SV40 Lawrence Cohen AV-1-PV3509...